Download Cancer MicroRNA qPCR Array with QuantiMir User Manual, v.1

Cancer MicroRNA qPCR Array
with QuantiMir™
Cat. # RA610A-1
User Manual
Store kit at -20°C on receipt
(ver. 1-070306)
A limited-use label license covers this
product. By use of this product, you
accept the terms and conditions outlined
in the Licensing and Warranty Statement
contained in this user manual.
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
Contents
I. Introduction and Background
A. Overview
B. Importance of MicroRNAs and Other Small RNAs
C. Overview of Entire Protocol
D. List of Components
E. Additional Required Materials
2
2
4
5
5
II. Protocol
A. QuantiMir™ RT Reaction Setup
B. Real-time qPCR Reaction Setup
C. How the MicroRNA-Specific Primers Are Designed
D. Cancer MicroRNA Array Arrangement
6
7
9
10
III. Quality Control and Sample Data
A. Cancer qPCR Array Primer Validation Tests
B. Sensitivity Tests
C. Specificity Tests
D. Sample Data
IV. Troubleshooting
13
14
15
16
18
V. References
A. General References
B. MicroRNA and Cancer References
19
20
VI. Appendix
A. Related Products
B. Technical Support
VII. Licensing and Warranty Statement
888-266-5066 (Toll Free)
650-968-2200 (outside US)
22
23
24
Page 1
System Biosciences (SBI)
User Manual
I. Introduction and Background
A. Overview
This manual provides details and information necessary to use the
QuantiMir™ RT Kit to tag and convert small non-coding RNAs into
detectable and quantifiable cDNAs. The system allows for the ability to
quantitate fold differences of 95 separate microRNAs between 2
separate experimental RNA samples. The array plate also includes the
U6 transcript as a normalization signal. All 95 microRNAs chosen for
the array have published implications with regard to potential roles in
cancer, cell development and apoptosis. To ensure optimal results,
please read the entire manual before using the reagents and material
supplied with this kit.
B. Importance of MicroRNAs and Other Small NonCoding RNAs
The field of non-coding RNAs has gained increasing attention in recent
years, particularly due to the discovery of small interfering RNAs
(siRNAs) and micro RNAs (miRNA). These RNAs are short (typically
19-24 nucleotides) single stranded moieties that regulate the
expression of target genes by interacting with complementary sites
within the target mRNAs and either repressing translation or eliciting
target mRNA degradation. miRNAs and siRNAs are conserved groups
of non-coding RNAs with very important regulatory roles.
Mature miRNAs and siRNAs are excised from stem-loop precursors,
which are themselves transcribed as part of longer primary transcripts.
These primary miRNAs appear to be first processed by the RNase
Drosha in the nucleus, after which the precursor miRNAs are exported
to the cytoplasm where the RNase Dicer further processes them.
These enzymes are also involved in the generation of mature small
inhibitory RNAs (siRNA) from exogenously transferred double stranded
siRNA precursors.
The current, standard method for detecting and quantifying novel
miRNA and siRNA molecules involves Northern blotting with
hybridization. Detecting and quantitating known miRNAs can be done
using pre-designed reverse priming and reverse transcription followed
by primer sets built for the specific miRNA for Real-time PCR analysis.
These sets require many steps and can take several hours to complete
and trouble-shoot. The QuantiMir™ RT kit provides all the reagents
necessary to anchor-tail and convert small, non-coding RNAs into
cDNA starting from total RNA samples. Once the user performs the
reactions on their RNA samples, the cDNAs are ready to use for either
End-point PCR experiments or to perform Real-time qPCR analysis.
MicroRNA expression signatures have become more clinically
Page 2
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
important recently with the discovery of distinct expression patterns
and fold changes observed in Normal versus Tumor RNA samples.
The Cancer MicroRNA qPCR Array with QuantiMir™ enables the
discovery of new MicroRNA signatures using 95 different MicroRNAs
known to be involved in apoptosis, cell fate, development, and cancer
from a diverse set of RNA samples.
Fig. 1. Diagram of MicroRNA biogenesis, processing and function.
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Page 3
System Biosciences (SBI)
User Manual
C. Overview of Entire Protocol
Discover MicroRNA Biomarkers!
Start with as little of 200 pg total RNA and convert to cDNA with the
QuantiMir™ RT System. Use this cDNA as template mixed in with a
SYBR® Green Mastermix plus the Universal reverse primer (included
in kit). Aliquot SYBR® Green Mastermix into qPCR optical plate.
Resuspend primers in Primer plate with 10µl RNase-free water, then
pipet 1µl of each of the MicroRNA-specific primers from the Primer
plate into the corresponding well of the qPCR plate (primer in well A1
goes into A1 in the qPCR plate, etc.). Perform Real-time PCR run and
analyze fold changes in 95 different MicroRNAs after normalizing to
the control U6 (well H12) in your 2 experimental sample tissues (in this
example, Normal vs. Carcinoma). You can use the quantitation results
MS Excel file provided on the CD with the kit to help you perform the
normalization and fold-differences calculations with graphical analysis
of your experiment if you choose.
Page 4
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
D. List of Components
Each MicroRNA Cancer qPCR Array Kit contains the following
components with enough material to perform 20 QuantiMir cDNA
synthesis reactions and enough Primers in the Primer Array plate to
perform 10 qPCR plates as outlined in this manual:
40 µl
5X PolyA Polymerase Buffer
10 µl Poly A Reaction
10 µl
PolyA Polymerase
(enough for 20 reactions)
20 µl
25 mM MnCl2
30 µl
5 mM ATP
10 µl
Oligo dT Adaptor
20 µl RT Reaction
80 µl
5X Reverse Transcriptase Buffer
(enough for 20 reactions)
20 µl
Reverse Transcriptase
30 µl
0.1 M Dithiothreitol (DTT)
40 µl
dNTP Mix
600 µl
3’ Universal Reverse PCR Primer
End-point or qPCR Assay
(enough for 1,200 reactions)
Array Primers, dried down in Primer plate
(100 µmoles); resuspend in 10µl RNase-free Water
1.2 ml
RNase-free Water
The kit is shipped on blue ice and should be stored at -20°C upon
arrival. Properly stored kits are stable for 1 year from the date received.
The oligonucleotides for the specific MicroRNAs are dried-down in the
wells of the optical qPCR plates. Resuspend in 10µl RNase-free water.
E. Additional Required Materials
•
•
•
•
•
•
•
•
•
Real-time qPCR Instrument
Instrument-specific optical qPCR plates
Thermocycler (with heated lid)
Thermocycler PCR tubes or plates for end-point reactions
PCR Mastermix, including Taq polymerase for PCR
3.0-3.5% Agarose Gel in Tris-Borate EDTA (TBE) or Tris-Acetate
EDTA (TAE) Buffer
DNA Size Ladder with markers from 50 to 2,000 bp (Bio-Rad
AmpliSize™ DNA Ladder; Cat. # 170-8200)
Nuclease-free water for qPCR reactions
IMPORTANT:
Recommended 2X SYBR Green qPCR Mastermixes:
SBI has tested and recommends SYBR Green Master mix from three
vendors: Power SYBR Master Mix® (Cat. #s 4368577, 4367650, 4367659,
4368706, 4368702, 4368708, 4367660) from Applied Biosystems; SYBR
GreenER™ qPCR SuperMix for ABI PRISM® instrument from Invitrogen
2
(Cat. #s 11760-100, 11760-500, and 11760-02K); and RT Real-Time™
SYBR Green / ROX PCR (Cat. #s PA-012 and PA-112) from SuperArray.
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Page 5
System Biosciences (SBI)
User Manual
II. Protocol
A. QuantiMir™ RT Reaction Setup
(for 1 RNA sample to be assayed on 1 qPCR plate)
It is important to start with total RNA that includes
the small RNA fraction. RNA input can be as low
as 10 ng/µl. For optimum signals, perform the
following.
Dilute your RNA to ~100 ng/µl
In a thin-walled PCR tube or
PCR-compatible plate well, combine:
Start:
5 µl
2 µl
+ 1 µl
1.5 µl
0.5 µl
10 µl
STEP 1:
PolyA Tail
Total RNA (~500ng)
5X PolyA Buffer
25mM MnCl2
5mM ATP
PolyA Polymerase
Total in tube
Incubate for 30 min. at 37°C
STEP 2:
Anneal Anchor
dT Adaptor
Add: + 0.5 µl Oligo dT Adaptor
Heat for 5 min. at 60°C
Let cool to room temp for 2 min.
Add:
STEP 3:
Synthesize
cDNAs
4 µl
2 µl
1.5 µl
+ 1.5 µl
1 µl
20.5 µl
5X RT Buffer
dNTP mix
0.1M DTT
RNase-free H2O
Reverse Transcriptase
Total in tube
Incubate for 60 min. at 42°C
Heat for 10 min. at 95°C
Done!
Page 6
* The QuantiMir™ cDNAs can be stored at -20°C. For more
sensitive applications, a single phenol:chloroform extraction
with ethanol precipitation can be performed on the cDNA to
remove proteins, unutilized dNTPs, and primers. Typically,
this is not necessary.
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
B. Real-time qPCR Reaction Setup
1. Mastermix qPCR Reaction Setup for 1 entire 96-well
qPCR plate
To determine the expression profile for your miRNAs under study,
mix the following for 1 entire qPCR plate:
For 1 entire plate:
+
1,750
60
20
1,670
3,500
µl
µl
µl
µl
µl
2X SYBR Green* qPCR Mastermix buffer
Universal Reverse Primer (10 µM)
User synthesized QuantiMir™ cDNA
RNase-free water
Total
Aliquot 29µl of Mastermix per well in your qPCR Plate.
* SBI has tested and recommends SYBR Green Master mix from three
vendors:
1. Power SYBR Master Mix® (Cat. #s 4368577, 4367650, 4367659,
4368706, 4368702, 4368708, 4367660) from Applied Biosystems
2. SYBR GreenER™ qPCR SuperMix for ABI PRISM® instrument from
Invitrogen (Cat. #s 11760-100, 11760-500, and 11760-02K)
3. RT² Real-Time™ SYBR Green / ROX PCR (Cat. #s PA-012 and PA112) from SuperArray.
Resuspend Primers in Primer plate with 10µl RNase-free water
per well before use. (the primers are dried-down in the Primer plate)
Then :
Load 1µl per well of each of the Primers from the Primer plate
into your qPCR plate (well A1 into qPCR plate A1, etc.)
The Mastermix contents can be scaled up or down depending upon on
your experimental needs. If you want to perform the reactions in
triplicate, scale up the QuantiMir reactions by 3-fold and add 3X the
RNA input. Or, simply follow the above recipe three times for each of
the qPCR plates you want to run as replicates. Once reagents are
loaded into the wells, cover the plate with an optical adhesive cover
and spin briefly in a centrifuge to bring contents to bottom of wells.
Place plate in the correct orientation (well A1, upper left) into the Realtime qPCR instrument and perform analysis run.
* Use a Multichannel pipette to load the qPCR
plate with MasterMix and Primers: Pour the
Mastermix into a reservoir trough and use a 8 or
12 channel pipette to load the entire 96-well
qPCR plate with the Mastermix. Then load the
primers from the primer plate to the qPCR plate
using a separate multichannel pipette.
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Page 7
System Biosciences (SBI)
User Manual
2. Real-time qPCR Instrument Parameters
Follow the guidelines as detailed for your specific Real-time
instrumentation. The following parameters tested by SBI were
performed on an Applied Biosystems 7300 Real-time PCR System
but can also apply to an ABI 7500 or an ABI 7900 96-well system.
The details of the thermal cycling conditions used in testing at SBI
are below. A screenshot from SBI’s ABI7300 Real-time instrument
setup is shown below also. Default conditions are used
throughout.
Create a detector:
Instrument Setup:
qPCR cycling and
data accumulation
conditions:
1.
2.
3.
4.
50°C 2 min.
95°C 10 min.
95°C 15 sec.
60°C 1 min.
(40 cycles of steps 3
and 4), data read at
60°C 15 sec. Step
(gold rectangle)
An additional recommendation is to include a melt analysis after
the qPCR run to assess the Tm of the PCR amplicon to verify the
specificity of the amplification reaction. Refer to the User Manual
for your specific instrument to conduct the melt analysis and the
data analyses of the amplification plots and Cycle Threshold (Ct)
calculations. In general, Cycle thresholds should be set within the
exponential phase of the amplification plots with software
automatic baseline settings.
Page 8
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
C. How the miRNA-Specific Primers are Designed for
Detection and Quantitation in the Array
MicroRNAs typically range in size from 19 – 24 nt. We recommend
using the exact sequence of the miRNA or siRNA being studied when
designing the forward primer. If the miRNA under study is known and
documented, using the miRBase database can be an easy starting
point:
(http://microrna.sanger.ac.uk/sequences/search.shtml).
An example of the known and documented miRNA, Human miR-16, is
shown below.
Hsa-miR-16
Simple: Directly use sequence
of mature miRNA as forward
primer in oligo design.
The mature miRNA sequence 5’ – uagcagcacguaaauauuggcg – 3’ can
be simply converted to a DNA sequence and used directly as the
forward primer for end-point and qPCR analysis.
Forward primer for hsa-miR-16 (included in kit):
5’ – TAGCAGCACGTAAATATTGGCG – 3’
Tm= 58.9°C, 45% GC and length = 22 bases.
All of the MicroRNA-specific primers for the QuantiMir™ Cancer qPCR
Array were designed in this fashion. For the MicroRNA family
members, degenerate primers were designed to detect the MicroRNA
family members as listed in the Array plate arrangement (Section
II.D.).
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Page 9
System Biosciences (SBI)
User Manual
D. Cancer MicroRNA Array Arrangement
All 95 microRNAs chosen for the array have published implications with
regard to potential roles in cancer, cell development and apoptosis
(see Section V.B.). The array plate also includes the U6 transcript as
a normalization signal (well H12). See accompanying data CD for
access to these details.
Page 10
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Cat. # RA610A-1
Page 11
System Biosciences (SBI)
Page 12
User Manual
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
III. Quality Control and Sample Data
A. Cancer qPCR Array Primer Validation Tests
1. Real-time qPCR Validation
The Cancer qPCR Array plate
was tested using a pool of 18
Normal and 7 Tumor RNA
samples converted to cDNA using
the QuantiMir RT Kit. The
resulting cDNA was tested using
0.5 µl per well. Shown at left is the
resulting Real-time amplification
plot for the entire plate. The Cts
ranged from 13.93 to 25.50,
reflecting over a 4-log fold
expression detection range. The
experiment was performed as
detailed
in
Section
II.E.
Quantitative
signals
were
observed for all wells in the array.
2. End-point PCR Validation
The Cancer qPCR Array plate
was tested using a pool of 18
Normal and 7 Tumor RNA
samples converted to cDNA using
the QuantiMir RT Kit.
The
resulting cDNA was tested using
0.5 µl per well. Shown at left is
the resulting End-point PCR
analysis with equal amount of
each PCR reaction loaded. The
PCR products were separated on
a 3.5% agarose gel and imaged.
The array locations are identical
to the well labels for the specific
MicroRNA primer being tested.
Various band intensities reflect
the spectrum of expression levels
observed for the particular
MicroRNA detected in the cDNA
sample pool.
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Page 13
System Biosciences (SBI)
User Manual
B. Sensitivity Tests
The QuantiMir™ cDNAs were synthesized using decreasing amounts
of total starting RNA input from a pool of Human Brain, Heart, Kidney,
Placenta, and Testes RNAs. Real-time quantitative qPCR assays were
performed with Forward primers specific for Human miR-16 and
Human miR-24 (For procedure, see Section II.D.1, Protocol: Real-time
qPCR).
Fig. 2. Real-time qPCR data for Human miR-16 and Human miR-24.
Real-time qPCR amplification plots are shown in the upper inset. Cycle
threshold (Ct) values were determined using the software automatic baseline
and Ct settings. The Bar graph depicts the relative %Signal per RNA input
amount for the microRNA. The graph below shows the linear regression
2
analysis with a R value of 0.971 for miR-16 and 0.993 for miR-24. Both
microRNAs are readily detectable down to 200 pg of total starting RNA input.
Page 14
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
C. Specificity Tests
To assess the specificity and proper orientation of the miRNA array,
oligonucleotide primers are synthesized both in the “sense” and the
“antisense” orientation. An example for the known, documented
miRNA miR-542-3p is detailed below.
Hsa-miR-542-3p
Sequence of mature miRNA
as forward primer in “sense”
oligo design, and then
designed in the “antisense”
oligo as control.
The mature miRNA sequence 5’ – ugugacagauugauaacugaaa – 3’ can
be converted to a DNA sequence along with designing its complement,
or “antisense” primer sequence.
Forward “sense” primer for hsa-miR-542-3p:
5’ – TGTGACAGATTGATAACTGAAA – 3’
Forward “antisense” primer for hsa-miR-542-3p:
5’ – TTTCAGTTATCAATCTGTCACA – 3’
Tm= 49.6°C, 32% GC and length = 22 bases.
Fig. 3. Sense and antisense test of the QuantiMir™ cDNA. Dilutions of
the QuantiMir™ cDNA template as well as no template controls (NTC) were
tested with either sense or antisense orientation for the Human miR-542-3p
molecule. Quantitative results are observed for the “sense” orientation of
miR-542-3p. No signals are observed in the “antisense” or no template
controls. The annealing temperature for the qPCR cycling conditions was
lowered to 50°C.
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Page 15
System Biosciences (SBI)
User Manual
D. Sample Data
1. Tissue Expression Pattern Determinations using the
QuantiMir™ Kit on Normal Human Tissues
The QuantiMir™ cDNA sets were synthesized from 18 separate
normal Human tissues and tested with 2 primers specific for 2
known miRNA molecules: miR-1 (heart and skeletal musclespecific) and miR-122a (abundant in liver). The amplification plots
and corresponding expression bar graphs are shown in Figure 4,
panels a and b.
a.
b.
Fig. 4. Real-time qPCR data using primers specific for Human miR-1
(Panel a.) and for miR-122a (Panel b.). The amplification plots are shown
on the left with the resulting expression profile bar graphs based on Ct
values is shown on the right. The default qPCR cycling conditions were
used with an annealing temperature of 60°C in Step 2 of Stage 3.
These two known miRNAs, miR-1 and mir-122a, have very
specific tissue expression patterns. Real-time qPCR data
confirmed that miR-1 is restricted to skeletal muscle and heart.
The sensitivity of the assays also reveals very low but detectable
signals in additional tissues. miR-122a is known to be highly
abundant in liver.
Page 16
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
2. Analysis of Tumor and Normal Tissue MicroRNA
Expression Levels using the QuantiMir™ Kit and Realtime qPCR
The QuantiMir™ cDNAs were synthesized from both Normal and
Tumor Breast, Lung, Ovary, Colon, and Lymph node RNAs.
MicroRNA forward primers specific for miR-9-1, miR-155, miR125, miR-145, miR-7, miR-17-3p, miR-18a, miR-20a and miR-92
were used to detect the corresponding microRNA species in the
tissues detailed in the expression graph below (Figure 5). The
signals were normalized to expression levels of the U6 snRNA
transcript. Fold increases and decreases in Normal vs. Tumor
tissues are graphed below and are consistent with published
findings for the particular microRNA in the specific tumor type.
Fig. 5. Quantitative analysis of MicroRNA expression in tumor and
normal tissue samples. The Bar graph data are grouped by tissue type
with normal tissues in blue bars and tumor tissues in red bars. The specific
MicroRNAs being detected are listed below the bar graphs. The expression
levels are normalized to U6 snRNA transcript levels to control for RNA input.
The MicroRNA expression levels are depicted as ∆Ct vales (Y axis). Realtime assays were performed as described in Section II.D.2 of this manual.
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Page 17
System Biosciences (SBI)
User Manual
IV. Troubleshooting
Problem
Possible Solution
Too much background in
qPCR signals
Use much less cDNA in the SYBR
Green Mastermix.
No qPCR signals
1. Did you select SYBR Green as
the Detector’s Reporter Dye?
2. Did the U6 control work?
3. Use more cDNA in Mastermix.
4. Check Mastermix contents and try
a subset with U6 as a positive
control.
5. Also try lowering the Annealing
Temperature to 50ºC.
How do I select the Threshold
level for Ct analysis?
Typically, place the threshold setting
in the upper third of the exponential
phase of the amplification curve.
Also, see the User Manual for your
specific instrument or contact their
technical support team for guidance.
Page 18
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
V. References
A. General References
1.
Sonthelmer, E. J., Carthew, R. W. 2005. Silence from within:
Endogenous siRNAs and miRNAs. Cell 122:9-12.
2.
Zamore, P.D., Haley, B. 2005. Ribo-gnome: The big world of small RNAs.
Science 309: 1519-1524.
3.
Bartel, D. 2004. MicroRNAs: Genomics, Biogenesis, Mechanism, and
Function. Cell 116: 281-297.
4.
Kim, Narry V. 2005.Small RNAs: Classification, Biogenesis, and Function.
Mol. Cells. 19:1-15.
5.
Valencia-Sanchez, MA., Liu, J., Hannon, GJ., Parker, R., 2006. Control
of translation and mRNA degradation by miRNAs and siRNAs. Genes Dev
20: 515-525.
6.
Lewis B.P, Burge C.B, Bartel, D.P. 2005. Conserved seed pairing, often
flanked by adenosines, indicates that thousands of human genes are
microRNA targets. Cell 120: 15-20.
7.
Xie X., Lu J., Kulbokas, E.J., Goulub, T.R., Mooth, V., Lindblad-Toh, K.,
Lander, E.S. and Kellis, M. Systematic discovery of regulatory motifs in
human promoters and 3’ UTRs by comparison of several mammals.
Nature.434:338-45.
8.
Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. 2001.
Identification of Novel Coding for Small Expresses RNAs. Science 294:
853-858.
9.
Basyuk, E., Suavet, F., Doglio, A., Bordonne, R., Bertrand, E. 2003.
Human let-7 stem-loop precursors harbor features of RNase III cleavage
products. Nucleic Acids Res 31: 6593-6597.
10. Chomczynski P., and Mackey, K. One-hour downward capillary blotting
of RNA at neutral pH. 1994, Anal. Biochem. 221, 303-305.
11. Shi, R., Chiang, V.L., 2005. Facile means for quantifying microRNA
expression by real-time PCR. BioTechniques. 39:519-525.
12. Ding, Y., Chan, C.Y., and Lawrence, C.E. (2005) RNA secondary
structure prediction by centroids in a Boltzmann weighted ensemble. RNA
11, 1157-1166.
13. Griffiths-Jones,S., Grocock, R.J., Van Dongen, S., Bateman, A.,
Enright, A.J. 2006. miRBase: microRNA sequences, targets and gene
nomenclature. Nucleic Acids Research 34: D140-D144.
14. Shingara, J., Keiger, K., Shelton, J., Laosinchai-Wolf, W., Powers, P.,
Conrad, R., Brown, D., Labourier, E. 2005. An optimized isolation and
labeling platform for accurate microRNA expression profiling. RNA
11:1461-1470.
15. He, L., Thomson, J.M., Hemann, M.T., Hernando-Monge, E., Mu, D.,
Goodson, S., Powers, S., Cordon-Cardo, C., Lowe, S.W., Hannon, G.J.,
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Page 19
System Biosciences (SBI)
User Manual
Hammond, S.M. 2005. A microRNA polycistron as a potential human
oncogene. Nature 435: 828-833.
16. Lai, E.C., Wiel, C., Rubin, G.M. 2004. Complementary miRNA pairs
suggest a regulatory role for miRNA:miRNA duplexes. RNA 10:171-175.
17. Ambros, V., Bartel, B., Bartel, D.P., Burge, C.B., Carrington, J.C.,
Chen, X., Dreyfuss, G., Eddy, S.R., Griffiths-Jones, S., Marshall, M.,
Matzke, M., Ruvkun, G., Tuschl, T. 2003. A uniform system for
microRNA annotation. RNA 9:277-279.
18. Obernosterer, G., Leuschner, P.J.F., Alenius, M., Martinez, J. 2006.
Post-transcriptional regulation of microRNA expression. RNA 12:1-7.
19. Dostie, J., Mourelatos, Z., Yang, M., Sharma, A., Dreyfuss, G. 2003.
Numerous microRNPs in neuronal cells containing novel microRNAs. RNA
9: 180-186.
B. MicroRNA and Cancer References
Breast Cancer
MicroRNA gene expression deregulation in human breast cancer.
Cancer Res. 2005 Aug 15;65(16):7065-70.
Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E,
Pedriali M, Fabbri M, Campiglio M, Menard S, Palazzo JP, Rosenberg A,
Musiani P, Volinia S, Nenci I, Calin GA, Querzoli P, Negrini M, Croce CM.
MicroRNA expression profiles classify human cancers.
Nature. 2005 Jun 9;435(7043):745-6.
Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J, Peck D, Sweet-Cordero
A, Ebert BL, Mak RH, Ferrando AA, Downing JR, Jacks T, Horvitz HR, Golub
TR.
B-cell Leukemia
MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic
leukemias.
Proc Natl Acad Sci U S A. 2004 Aug 10;101(32):11755-60. Epub 2004 Jul 29.
Calin GA, Liu CG, Sevignani C, Ferracin M, Felli N, Dumitru CD, Shimizu M,
Cimmino A, Zupo S, Dono M, Dell'Aquila ML, Alder H, Rassenti L, Kipps TJ,
Bullrich F, Negrini M, Croce CM.
A MicroRNA signature associated with prognosis and progression in chronic
lymphocytic leukemia.
N Engl J Med. 2005 Oct 27;353(17):1793-801.
Calin GA, Ferracin M, Cimmino A, Di Leva G, Shimizu M, Wojcik SE, Iorio MV,
Visone R, Sever NI, Fabbri M, Iuliano R, Palumbo T, Pichiorri F, Roldo C,
Garzon R, Sevignani C, Rassenti L, Alder H, Volinia S, Liu CG, Kipps TJ,
Negrini M, Croce CM.
Lung Cancer
Unique microRNA molecular profiles in lung cancer diagnosis and prognosis.
Cancer Cell. 2006 Mar;9(3):189-98.
Yanaihara N, Caplen N, Bowman E, Seike M, Kumamoto K, Yi M, Stephens
RM, Okamoto A, Yokota J, Tanaka T, Calin GA, Liu CG, Croce CM, Harris CC.
Page 20
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
A polycistronic microRNA cluster, miR-17-92, is overexpressed in human lung
cancers and enhances cell proliferation.
Cancer Res. 2005 Nov 1;65(21):9628-32.
Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S,
Yatabe Y, Kawahara K, Sekido Y, Takahashi T.
MicroRNA and lung cancer.
N Engl J Med. 2005 Jun 9;352(23):2446-8.
Eder M, Scherr M.
Pancreatic Cancer
Expression profiling identifies microRNA signature in pancreatic cancer.
Int J Cancer. 2006 Dec 5; [Epub ahead of print]
Lee EJ, Gusev Y, Jiang J, Nuovo GJ, Lerner MR, Frankel WL, Morgan DL,
Postier RG, Brackett DJ, Schmittgen TD.
Solid Tumors:
A microRNA expression signature of human solid tumors defines cancer
gene targets.
Proc Natl Acad Sci U S A. 2006 Feb 14;103(7):2257-61. Epub 2006 Feb 3.
Volinia S, Calin GA, Liu CG, Ambs S, Cimmino A, Petrocca F, Visone R, Iorio
M, Roldo C, Ferracin M, Prueitt RL, Yanaihara N, Lanza G, Scarpa A,
Vecchione A, Negrini M, Harris CC, Croce CM.
MicroRNA and Cancer Reviews/Other Publications
Cancer genomics: small RNAs with big impacts.
Nature. 2005 Jun 9;435(7043):745-6.
Meltzer, PS.
MicroRNAs in Gene Regulation: When the Smallest Governs It All.
J Biomed Biotechnol. 2006;2006(4):69616.
Ouellet DL, Perron MP, Gobeil LA, Plante P, Provost P.
MicroRNAs as oncogenes.
Curr Opin Genet Dev. 2006 Feb;16(1):4-9. Epub 2005 Dec 19.
Hammond SM.
Oncomirs - microRNAs with a role in cancer.
Nat Rev Cancer. 2006 Apr;6(4):259-69.
Esquela-Kerscher A, Slack FJ.
MicroRNAs as oncogenes and tumor suppressors.
Dev Biol. 2006 Aug 16; [Epub ahead of print]
Zhang B, Pan X, Cobb GP, Anderson TA.
MicroRNAs and the hallmarks of cancer.
Oncogene. 2006 Oct 9;25(46):6170-5.
Dalmay T, Edwards DR
MicroRNAs exhibit high frequency genomic alterations in human cancer.
Proc Natl Acad Sci U S A. 2006 Jun 13;103(24):9136-41. Epub 2006 Jun 5.
Zhang L, Huang J, Yang N, Greshock J, Megraw MS, Giannakakis A, Liang S,
Naylor TL, Barchetti A, Ward MR, Yao G, Medina A, O'brien-Jenkins A,
Katsaros D, Hatzigeorgiou A, Gimotty PA, Weber BL, Coukos G.
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Page 21
System Biosciences (SBI)
User Manual
VI. Appendix
A. Related Products
•
QuantiMir™ RT Kit (Cat. # RA420A-1)
Complete reagent kit for anchor-tagging small RNAs and
converting them to quantifiable cDNA. Kit contains enough
reagents for 20 RT reactions and can generate hundreds of qPCR
templates. A universal reverse adaptor primer and positive control
primers for Human U6 snRNA and Human miR-16 are also
included with the kit.
•
miRANDA™ qPCR-Ready miRNA Tissue Expression Array Kit
(Cat. # RA600A-1)
18 Human individual normal tissue miRNA cDNAs arrayed into a
qPCR optical plate (4 complete sets of the 18 tissues, 72 individual
reactions). A universal reverse adaptor primer and a positive
control forward primer (U6 snRNA) are also included with the kit.
•
miRANDA™ Universal miRNA cDNA template
(Cat. # RA650A-1)
Pool of all 18 Human miRNA cDNAs (enough for 20 50 µlreactions), a universal reverse adaptor primer, and a positive
control forward primer (U6 snRNA)
•
MicroRNA Discovery™ Kit (Cat. # RA410A-1)
Rapid identification of new MicroRNAs and MicroRNA-like
molecules. Amplification and cloning can be initiated in a single
day (3 steps, 1 day.) The alternative method takes approximately 1
week (9 steps.)
•
Pre-Made MicroRNA-Enriched cDNAs (Cat. # RA500A-1 –
RA509A-1)
Tissue-specific amplified cDNA generated by SBI using the
MicroRNA Discovery™ Kit can be used for cloning microRNA.
•
Global MicroRNA Amplification Kit (Cat. # RA400A-1)
Simple amplification kit allows cDNA amplification for qRT-PCR
and microarray studies from as little as 50 ng of starting total RNA.
•
Full Spectrum™ Complete Transcriptome RNA Amplification
Kit (Cat. # RA101A-1)
The Full Spectrum RNA Amplification Kit provides an inexpensive
method to amplify reverse transcribed RNA in a sequence
independent, unbiased, and uniform manner with better
representation of 5’ end of mRNA sequences. This approach
maintains the relative levels of each transcript in the starting
Page 22
ver. 1-070306
www.systembio.com
Cancer MicroRNA qPCR Array with QuantiMir™
Cat. # RA610A-1
mRNA samples—even when using starting amounts of RNA as
low as 5ng or when using heavily degraded RNA.
•
Full Spectrum™ MultiStart Primers for T7 IVT
(Cat. # RA300A-2)
Extract more data from your RNA than currently available primers
in nearly all commercially-available T7 IVT kits using Full
Spectrum™ technology. Just replace the existing T7 primer with
the Full Spectrum™ primers. Compatible with Affymetrix
GeneChip® hybridization.
B. Technical Support
For more information about SBI products and to download manuals in
PDF format, please visit our web site:
http://www.systembio.com
For additional information or technical assistance, please call or email
us at:
System Biosciences (SBI)
1616 North Shoreline Blvd.
Mountain View, CA 94043
Phone: (650) 968-2200
(888) 266-5066 (Toll Free)
Fax:
(650) 968-2277
E-mail:
General Information:
[email protected]
Technical Support:
[email protected]
Ordering Information:
[email protected]
888-266-5066 (Toll Free)
650-968-2200 (outside US)
Page 23
System Biosciences (SBI)
User Manual
VII. Licensing and Warranty Statement
Limited Use License
Use of the Cancer MicroRNA qPCR Array Kit wth QuantiMir™ (i.e., the “Product”)
is subject to the following terms and conditions. If the terms and conditions are not
acceptable, return all components of the Product to System Biosciences (SBI)
within 7 calendar days. Purchase and use of any part of the Product constitutes
acceptance of the above terms.
Purchase of the product does not grant any rights or license for use other than
those explicitly listed in this Licensing and Warranty Statement. Use of the
Product for any use other than described expressly herein may be covered by
patents or subject to rights other than those mentioned. SBI disclaims any and all
responsibility for injury or damage which may be caused by the failure of the buyer
or any other person to use the Product in accordance with the terms and
conditions outlined herein.
SBI has pending patent applications related to the Product. For information
concerning licenses for commercial use, contact SBI.
Limited Warranty
SBI warrants that the Product meets the specifications described in the
accompanying Product Analysis Certificate. If it is proven to the satisfaction of SBI
that the Product fails to meet these specifications, SBI will replace the Product or
provide the purchaser with a refund. This limited warranty shall not extend to
anyone other than the original purchaser of the Product. Notice of nonconforming
products must be made to SBI within 30 days of receipt of the Product.
SBI’s liability is expressly limited to replacement of Product or a refund limited to
the actual purchase price. SBI’s liability does not extend to any damages arising
from use or improper use of the Product, or losses associated with the use of
additional materials or reagents. This limited warranty is the sole and exclusive
warranty. SBI does not provide any other warranties of any kind, expressed or
implied, including the merchantability or fitness of the Product for a particular
purpose.
SBI is committed to providing our customers with high-quality products. If you
should have any questions or concerns about any SBI products, please contact us
at (888) 266-5066.
© 2007 System Biosciences (SBI).
Page 24
ver. 1-070306
www.systembio.com