Download Attachment PDF Icon

SMARTer™ PCR cDNA Synthesis Kit User Manual
I. List of Components
SMARTer PCR cDNA Synthesis Kit
Cat. No.
634925
10 rxns
Cat. No.
634926
20 rxns
Box 1
•
10 µl
20 µl
SMARTer II A Oligonucleotide (12 µM)
5'–AAGCAGTGGTATCAACGCAGAGTACXXXXX–3'
Rsa I
(X = undisclosed base in the proprietary SMARTer oligo sequence)
•
5 µl
5 µl
Control Mouse Liver Total RNA (1 µg/µl)
Box 2
•
10 µl
20 µl
3’ SMART CDS Primer II A (12 µM)
5’–AAGCAGTGGTATCAACGCAGAGTACT(30)N-1N–3’
Rsa I
(N = A, C, G, or T; N-1 = A, G, or C)
• 200 µl
5’ PCR Primer II A (12 µM)
•
40 µl
400 µl
80 µl
5X First-Strand Buffer (RNase-Free)
250 mM Tris-HCl (pH 8.3)
375 mM KCl
• 100 µl
30 mM MgCl2
200 µl
dNTP Mix (dATP, dCTP, dGTP, and dTTP, each at 10 mM)
•
50 µl
50 µl
Dithiothreitol (DTT; 100 mM)
•
10 µl
10 µl
RNase Inhibitor (40 U/µl)
•
12 µl
25 µl
SMARTScribe™ Reverse Transcriptase (100 U/µl)
•
1 ml
1 ml
Deionized H2O
Box 3
•
10
20
CHROMA SPIN™+TE-1000 Columns
Storage Conditions
• Store Control Mouse Liver Total RNA and SMARTer II A Oligonucleotide at –70°C.
• Store the CHROMA SPIN +TE-1000 Columns at room temperature.
• Store all other reagents at –20°C.
Licensing Information
For important information about the use of SMART technology, please see the Notice to Purchaser at the
end of this user manual.
Clontech Laboratories, Inc. www.clontech.com
A Takara Bio Company
Protocol No. PT4097-1
Version No. 013012
3