1
Download mavolcanoplot
Transcript
oligoprop use property name/property value pairs. You can specify one or more properties in any order. Each PropertyName must be enclosed in single quotation marks and is case insensitive. These property name/property value pairs are as follows: SeqProperties = oligoprop(SeqNT, ...'Salt', SaltValue, ...) specifies a salt concentration in moles/liter for melting temperature calculations. Default is 0.05 moles/liter. SeqProperties = oligoprop(SeqNT, ...'Temp', TempValue, ...) specifies the temperature in degrees Celsius for nearest-neighbor calculations of free energy. Default is 25 degrees Celsius. SeqProperties = oligoprop(SeqNT, ...'Primerconc', PrimerconcValue, ...) specifies the concentration in moles/liter for melting temperatures. Default is 50e-6 moles/liter. SeqProperties = oligoprop(SeqNT, ...'HPBase', HPBaseValue, ...) specifies the minimum number of paired bases that form the neck of the hairpin. Default is 4 base pairs. SeqProperties = oligoprop(SeqNT, ...'HPLoop', HPLoopValue, ...) specifies the minimum number of bases that form the loop of a hairpin. Default is 2 bases. SeqProperties = oligoprop(SeqNT, ...'Dimerlength', DimerlengthValue, ...) specifies the minimum number of aligned bases between the sequence and its reverse. Default is 4 bases. Examples Calculating Properties for a DNA Sequence 1 Create a random sequence. seq = randseq(25) seq = TAGCTTCATCGTTGACTTCTACTAA 2 Calculate sequence properties of the sequence. 2-536
