1
Download mavolcanoplot
Transcript
restrict can use CuttingSites+1 to point to the first base of every fragment respective to the original sequence. [Fragments, CuttingSites, Lengths] = restrict(...) returns a numeric vector with the lengths of every fragment. ... = restrict(..., 'PartialDigest', PartialDigestValue) simulates a partial digest where each restriction site in the sequence has a probability (PartialDigestValue) of being cut. REBASE, the restriction enzyme database, is a collection of information about restriction enzymes and related proteins. For more information about REBASE or to search REBASE for the name of a restriction enzyme, go to the REBASE Web site at http://rebase.neb.com/rebase/rebase.html Examples 1 Enter a nucleotide sequence. Seq = 'AGAGGGGTACGCGCTCTGAAAAGCGGGAACCTCGTGGCGCTTTATTAA'; 2 Use the recognition pattern (sequence) GCGC with the point of cleavage at position 3 to cleave a nucleotide sequence. fragmentsPattern = restrict(Seq,'GCGC',3) fragmentsPattern = 'AGAGGGGTACGCG' 'CTCTGAAAAGCGGGAACCTCGTGGCG' 'CTTTATTAA' 3 Use the restriction enzyme HspAI (recognition sequence GCGC with the point of cleavage at position 1) to cleave a nucleotide sequence. fragmentsEnzyme = restrict(Seq,'HspAI') fragmentsEnzyme = 'AGAGGGGTACG' 'CGCTCTGAAAAGCGGGAACCTCGTGG' 'CGCTTTATTAA' 2-609
