Download Spectrophotometer User Guide
Transcript
Direct UV measurement of ssDNA test results Oligonucleotide measurement – calculated factor The Oligonucleotide test with a calculated factor measures absorbance at 260 nm and uses a calculated factor to convert absorbance to concentration. The instrument uses the molecular weight and the extinction coefficient to calculate the factor. * OLIGOS (CALC) * TEST NAME WAVELENGTH DILUTION MULTIPLIER UNITS ID# (0=OFF) AUTOPRINT OLIGOS (CALC) 260.0 nm 1.00 µg/ml, pmol/µl 0 OFF BASE SEQUENCE = ATCGTCGATTGAGCATCAGCATGACTAGAGATCAGAA TCGCG BASE SEQUENCE FACTOR 26.68 BASE SEQ. PRINT TEST SAVE TEST STORED TESTS VIEW RESULTS Oligonucleotide test parameters (calculated factor) Spectrophotometer User Guide 61