Download Mandatory qualifiers

(Option 0 in the list of things to display). For example:
% showseq tembl:eclac -sbeg 1 -send 120
Display a sequence with features, translation etc..
Output file [stdout]:
Things to display
0 : Enter your own list of things to display
1 : Sequence only
2 : Default sequence with features
3 : Pretty sequence
4 : One frame translation
5 : Three frame translations
6 : Six frame translations
7 : Restriction enzyme map
8 : Baroque
Display format [2]: 0
Specify your own things to display
S : Sequence
B : Blank line
1 : Frame1 translation
2 : Frame2 translation
3 : Frame3 translation
-1 : CompFrame1 translation
-2 : CompFrame2 translation
-3 : CompFrame3 translation
T : Ticks line
N : Number ticks line
C : Complement sequence
F : Features
R : Restriction enzyme cut sites in forward sense
-R : Restriction enzyme cut sites in reverse sense
A : Annotation
Enter a list of things to display [B N T S A F]: b,s,t,c
Output file [eclac.showseq]: stdout
ECLAC
E.coli lactose operon with lacI, lacZ, lacY and lacA genes.
gacaccatcgaatggcgcaaaacctttcgcggtatggcatgatagcgcccggaagagagt
----:----|----:----|----:----|----:----|----:----|----:----|
ctgtggtagcttaccgcgttttggaaagcgccataccgtactatcgcgggccttctctca
caattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcagagtatgccggt
----:----|----:----|----:----|----:----|----:----|----:----|
gttaagtcccaccacttacactttggtcattgcaatatgctacagcgtctcatacggcca
By choosing format "0" and specifying that we want to display the things: "b,s,t,c", we will output the
sequence in the following way.
For every new line that the sequence starts to write, the output display will contain first a blank line ("b"),
then the sequence itself ("s"), a line of with ticks every 10 characters ("t"), and the reverse complement of
the sequence ("c'"). Subsequent lines of the sequence output will repeat this format.