Download CLC bio

Manual for
CLC Protein Workbench 5.8
Windows, Mac OS X and Linux
February 23, 2012
This software is for research purposes only.
CLC bio
Finlandsgade 10-12
DK-8200 Aarhus N
Denmark
Contents
I
Introduction
9
1 Introduction to CLC Protein Workbench
10
1.1
Contact information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
12
1.2
Download and installation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
12
1.3
System requirements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
15
1.4
Licenses . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
15
1.5
About CLC Workbenches
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
27
1.6
When the program is installed: Getting started . . . . . . . . . . . . . . . . . . .
29
1.7
Plug-ins . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
30
1.8
Network configuration . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
33
1.9
The format of the user manual . . . . . . . . . . . . . . . . . . . . . . . . . . .
34
2 Tutorials
36
2.1
Tutorial: Getting started . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
37
2.2
Tutorial: View sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
38
2.3
Tutorial: Side Panel Settings . . . . . . . . . . . . . . . . . . . . . . . . . . . .
40
2.4
Tutorial: GenBank search and download . . . . . . . . . . . . . . . . . . . . . .
43
2.5
Tutorial: BLAST search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
44
2.6
Tutorial: Tips for specialized BLAST searches . . . . . . . . . . . . . . . . . . .
47
2.7
Tutorial: Proteolytic cleavage detection . . . . . . . . . . . . . . . . . . . . . . .
52
2.8
Tutorial: Align protein sequences . . . . . . . . . . . . . . . . . . . . . . . . . .
54
2.9
Tutorial: Create and modify a phylogenetic tree . . . . . . . . . . . . . . . . . .
56
2.10 Tutorial: Find restriction sites . . . . . . . . . . . . . . . . . . . . . . . . . . . .
57
3
CONTENTS
II
4
Core Functionalities
60
3 User interface
61
3.1
Navigation Area . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
62
3.2
View Area . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
69
3.3
Zoom and selection in View Area . . . . . . . . . . . . . . . . . . . . . . . . . .
76
3.4
Toolbox and Status Bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
78
3.5
Workspace . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
79
3.6
List of shortcuts . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
80
4 Searching your data
83
4.1
What kind of information can be searched? . . . . . . . . . . . . . . . . . . . .
83
4.2
Quick search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
84
4.3
Advanced search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
86
4.4
Search index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
88
5 User preferences and settings
89
5.1
General preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
89
5.2
Default view preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
90
5.3
Advanced preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
93
5.4
Export/import of preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . .
94
5.5
View settings for the Side Panel
95
. . . . . . . . . . . . . . . . . . . . . . . . . .
6 Printing
98
6.1
Selecting which part of the view to print . . . . . . . . . . . . . . . . . . . . . .
99
6.2
Page setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100
6.3
Print preview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101
7 Import/export of data and graphics
102
7.1
Bioinformatic data formats . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102
7.2
External files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
7.3
Export graphics to files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
7.4
Export graph data points to a file . . . . . . . . . . . . . . . . . . . . . . . . . . 113
7.5
Copy/paste view output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115
CONTENTS
5
8 History log
8.1
116
Element history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116
9 Batching and result handling
9.1
III
118
How to handle results of analyses . . . . . . . . . . . . . . . . . . . . . . . . . 118
Bioinformatics
121
10 Viewing and editing sequences
122
10.1 View sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 122
10.2 Circular DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 130
10.3 Working with annotations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 133
10.4 Element information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141
10.5 View as text . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 142
10.6 Creating a new sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 142
10.7 Sequence Lists
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 143
11 Online database search
148
11.1 GenBank search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 148
11.2 UniProt (Swiss-Prot/TrEMBL) search . . . . . . . . . . . . . . . . . . . . . . . . 152
11.3 Search for structures at NCBI . . . . . . . . . . . . . . . . . . . . . . . . . . . . 154
11.4 Sequence web info
12 BLAST Search
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 158
160
12.1 Running BLAST searches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161
12.2 Output from BLAST searches . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167
12.3 Local BLAST databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
12.4 Manage BLAST databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175
12.5 Bioinformatics explained: BLAST . . . . . . . . . . . . . . . . . . . . . . . . . . 176
13 3D molecule viewing
186
13.1 Importing structure files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186
13.2 Viewing structure files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
13.3 Selections and display of the 3D structure . . . . . . . . . . . . . . . . . . . . . 188
CONTENTS
6
13.4 3D Output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193
14 General sequence analyses
195
14.1 Shuffle sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 195
14.2 Dot plots . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 197
14.3 Local complexity plot
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 207
14.4 Sequence statistics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 208
14.5 Join sequences . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 214
14.6 Pattern Discovery . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 215
14.7 Motif Search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 217
15 Nucleotide analyses
225
15.1 Convert DNA to RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225
15.2 Convert RNA to DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 226
15.3 Reverse complements of sequences . . . . . . . . . . . . . . . . . . . . . . . . 227
15.4 Reverse sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228
15.5 Translation of DNA or RNA to protein . . . . . . . . . . . . . . . . . . . . . . . . 228
15.6 Find open reading frames . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 230
16 Protein analyses
233
16.1 Signal peptide prediction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 234
16.2 Protein charge . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240
16.3 Transmembrane helix prediction . . . . . . . . . . . . . . . . . . . . . . . . . . 241
16.4 Antigenicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 242
16.5 Hydrophobicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 244
16.6 Pfam domain search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
16.7 Secondary structure prediction . . . . . . . . . . . . . . . . . . . . . . . . . . . 251
16.8 Protein report
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 253
16.9 Reverse translation from protein into DNA . . . . . . . . . . . . . . . . . . . . . 255
16.10 Proteolytic cleavage detection . . . . . . . . . . . . . . . . . . . . . . . . . . . . 259
17 Restriction site analyses
265
17.1 Dynamic restriction sites . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 266
17.2 Restriction site analysis from the Toolbox . . . . . . . . . . . . . . . . . . . . . 270
CONTENTS
7
17.3 Gel electrophoresis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 275
17.4 Restriction enzyme lists . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 278
18 Sequence alignment
282
18.1 Create an alignment . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 283
18.2 View alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 288
18.3 Edit alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292
18.4 Join alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 294
18.5 Pairwise comparison . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 296
18.6 Bioinformatics explained: Multiple alignments . . . . . . . . . . . . . . . . . . . 299
19 Phylogenetic trees
301
19.1 Inferring phylogenetic trees . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 301
19.2 Bioinformatics explained: phylogenetics . . . . . . . . . . . . . . . . . . . . . . 306
IV
Appendix
310
A Comparison of workbenches
311
B Graph preferences
316
C Working with tables
318
C.1
Filtering tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 319
D BLAST databases
321
D.1
Peptide sequence databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . 321
D.2
Nucleotide sequence databases . . . . . . . . . . . . . . . . . . . . . . . . . . 321
D.3
Adding more databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 322
E Proteolytic cleavage enzymes
324
F Formats for import and export
326
F.1
List of bioinformatic data formats . . . . . . . . . . . . . . . . . . . . . . . . . . 326
F.2
List of graphics data formats . . . . . . . . . . . . . . . . . . . . . . . . . . . . 329
G IUPAC codes for amino acids
330
CONTENTS
8
H IUPAC codes for nucleotides
332
I
333
Custom codon frequency tables
Bibliography
334
V
339
Index
Part I
Introduction
9
Chapter 1
Introduction to CLC Protein Workbench
Contents
1.1
1.2
Contact information . . . . . . . . . . . . . . .
Download and installation . . . . . . . . . . .
1.2.1
Program download . . . . . . . . . . . . .
1.2.2
Installation on Microsoft Windows . . . .
1.2.3
Installation on Mac OS X . . . . . . . . .
1.2.4
Installation on Linux with an installer . . .
1.2.5
Installation on Linux with an RPM-package
1.3
System requirements . . . . . . . . . . . . . .
1.4
Licenses . . . . . . . . . . . . . . . . . . . . .
1.4.1
Request an evaluation license . . . . . .
1.4.2
Download a license . . . . . . . . . . . .
1.4.3
Import a license from a file . . . . . . . .
1.4.4
Upgrade license . . . . . . . . . . . . . .
1.4.5
Configure license server connection . . .
1.4.6
Limited mode . . . . . . . . . . . . . . .
1.5
About CLC Workbenches . . . . . . . . . . . .
1.5.1
New program feature request . . . . . . .
1.5.2
Report program errors . . . . . . . . . . .
1.5.3
CLC Sequence Viewer vs. Workbenches .
1.6
When the program is installed: Getting started
1.6.1
Quick start . . . . . . . . . . . . . . . . .
1.6.2
Import of example data . . . . . . . . . .
1.7
Plug-ins . . . . . . . . . . . . . . . . . . . . .
1.7.1
Installing plug-ins . . . . . . . . . . . . .
1.7.2
Uninstalling plug-ins . . . . . . . . . . . .
1.7.3
Updating plug-ins . . . . . . . . . . . . .
1.7.4
Resources . . . . . . . . . . . . . . . . .
1.8
Network configuration . . . . . . . . . . . . .
1.9
The format of the user manual . . . . . . . . .
1.9.1
Text formats . . . . . . . . . . . . . . . .
10
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
12
12
12
12
13
14
15
15
15
16
19
21
21
24
27
27
28
28
29
29
29
30
30
30
31
32
32
33
34
35
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
11
Welcome to CLC Protein Workbench --- a software package supporting your daily bioinformatics
work.
We strongly encourage you to read this user manual in order to get the best possible basis for
working with the software package.
This software is for research purposes only.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
1.1
12
Contact information
The CLC Protein Workbench is developed by:
CLC bio A/S
Science Park Aarhus
Finlandsgade 10-12
8200 Aarhus N
Denmark
http://www.clcbio.com
VAT no.: DK 28 30 50 87
Telephone: +45 70 22 55 09
Fax: +45 70 22 55 19
E-mail: [email protected]
If you have questions or comments regarding the program, you are welcome to contact our
support function:
E-mail: [email protected]
1.2
Download and installation
The CLC Protein Workbench is developed for Windows, Mac OS X and Linux. The software for
either platform can be downloaded from http://www.clcbio.com/download.
1.2.1
Program download
The program is available for download on http://www.clcbio.com/download.
Before you download the program you are asked to fill in the Download dialog.
In the dialog you must choose:
• Which operating system you use
• Whether you would like to receive information about future releases
Depending on your operating system and your Internet browser, you are taken through some
download options.
When the download of the installer (an application which facilitates the installation of the
program) is complete, follow the platform specific instructions below to complete the installation
procedure. 1
1.2.2
Installation on Microsoft Windows
Starting the installation process is done in one of the following ways:
1
You must be connected to the Internet throughout the installation process.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
13
If you have downloaded an installer:
Locate the downloaded installer and double-click the icon.
The default location for downloaded files is your desktop.
If you are installing from a CD:
Insert the CD into your CD-ROM drive.
Choose the "Install CLC Protein Workbench" from the menu displayed.
Installing the program is done in the following steps:
• On the welcome screen, click Next.
• Read and accept the License agreement and click Next.
• Choose where you would like to install the application and click Next.
• Choose a name for the Start Menu folder used to launch CLC Protein Workbench and click
Next.
• Choose if CLC Protein Workbench should be used to open CLC files and click Next.
• Choose where you would like to create shortcuts for launching CLC Protein Workbench and
click Next.
• Choose if you would like to associate .clc files to CLC Protein Workbench. If you check this
option, double-clicking a file with a "clc" extension will open the CLC Protein Workbench.
• Wait for the installation process to complete, choose whether you would like to launch CLC
Protein Workbench right away, and click Finish.
When the installation is complete the program can be launched from the Start Menu or from one
of the shortcuts you chose to create.
1.2.3
Installation on Mac OS X
Starting the installation process is done in one of the following ways:
If you have downloaded an installer:
Locate the downloaded installer and double-click the icon.
The default location for downloaded files is your desktop.
If you are installing from a CD:
Insert the CD into your CD-ROM drive and open it by double-clicking on the CD icon on your
desktop.
Launch the installer by double-clicking on the "CLC Protein Workbench" icon.
Installing the program is done in the following steps:
• On the welcome screen, click Next.
• Read and accept the License agreement and click Next.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
14
• Choose where you would like to install the application and click Next.
• Choose if CLC Protein Workbench should be used to open CLC files and click Next.
• Choose whether you would like to create desktop icon for launching CLC Protein Workbench
and click Next.
• Choose if you would like to associate .clc files to CLC Protein Workbench. If you check this
option, double-clicking a file with a "clc" extension will open the CLC Protein Workbench.
• Wait for the installation process to complete, choose whether you would like to launch CLC
Protein Workbench right away, and click Finish.
When the installation is complete the program can be launched from your Applications folder, or
from the desktop shortcut you chose to create. If you like, you can drag the application icon to
the dock for easy access.
1.2.4
Installation on Linux with an installer
Navigate to the directory containing the installer and execute it. This can be done by running a
command similar to:
# sh CLCProteinWorkbench_5_JRE.sh
If you are installing from a CD the installers are located in the "linux" directory.
Installing the program is done in the following steps:
• On the welcome screen, click Next.
• Read and accept the License agreement and click Next.
• Choose where you would like to install the application and click Next.
For a system-wide installation you can choose for example /opt or /usr/local. If you do not
have root privileges you can choose to install in your home directory.
• Choose where you would like to create symbolic links to the program
DO NOT create symbolic links in the same location as the application.
Symbolic links should be installed in a location which is included in your environment PATH.
For a system-wide installation you can choose for example /usr/local/bin. If you do not have
root privileges you can create a 'bin' directory in your home directory and install symbolic
links there. You can also choose not to create symbolic links.
• Wait for the installation process to complete and click Finish.
If you choose to create symbolic links in a location which is included in your PATH, the program
can be executed by running the command:
# clcproteinwb5
Otherwise you start the application by navigating to the location where you choose to install it
and running the command:
# ./clcproteinwb5
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
1.2.5
15
Installation on Linux with an RPM-package
Navigate to the directory containing the rpm-package and install it using the rpm-tool by running
a command similar to:
# rpm -ivh CLCProteinWorkbench_5_JRE.rpm
If you are installing from a CD the rpm-packages are located in the "RPMS" directory.
Installation of RPM-packages usually requires root-privileges.
When the installation process is finished the program can be executed by running the command:
# clcproteinwb5
1.3
System requirements
The system requirements of CLC Protein Workbench are these:
• Windows XP, Windows Vista, or Windows 7, Windows Server 2003 or Windows Server 2008
• Mac OS X 10.5 or newer. PowerPC G4, G5 or Intel CPU required.
• Linux: RedHat 5 or later. SuSE 10 or later.
• 32 or 64 bit
• 256 MB RAM required
• 512 MB RAM recommended
• 1024 x 768 display recommended
1.4
Licenses
When you have installed CLC Protein Workbench, and start for the first time, you will meet the
license assistant, shown in figure 1.1.
The following options are available. They will be described in detail in the following sections.
• Request an evaluation license. The license is a fully functional, time-limited license (see
below).
• Download a license. When you purchase a license, you will get a license ID from CLC bio.
Using this option, you will get a license based on this ID.
• Import a license from a file. If CLC bio has provided a license file, or if you have downloaded
a license from our web-based licensing system, you can import it using this option.
• Upgrade license. If you already have used a previous version of CLC Protein Workbench,
and you are entitled to upgrading to the new CLC Protein Workbench 5.8, select this option
to get a license upgrade.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
16
Figure 1.1: The license assistant showing you the options for getting started.
• Configure license server connection. If your organization has a license server, select this
option to connect to the server.
Select an appropriate option and click Next.
If for some reason you don't have access to getting a license, you can click the Limited Mode
button (see section 1.4.6).
1.4.1
Request an evaluation license
We offer a fully functional demo version of CLC Protein Workbench to all users, free of charge.
Each user is entitled to 30 days demo of CLC Protein Workbench. If you need more time for
evaluating, another two weeks of demo can be requested.
We use the concept of "quid quo pro". The last two weeks of free demo time given to you is
therefore accompanied by a short-form questionnaire where you have the opportunity to give us
feedback about the program.
The 30 days demo is offered for each major release of CLC Protein Workbench. You will therefore
have the opportunity to try the next major version when it is released. (If you purchase CLC
Protein Workbench the first year of updates is included.)
When you select to request an evaluation license, you will see the dialog shown in figure 1.2.
In this dialog, there are two options:
• Direct download. The workbench will attempt to contact the online CLC Licenses Service,
and download the license directly. This method requires internet access from the workbench.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
17
Figure 1.2: Choosing between direct download or download web page.
• Go to license download web page. The workbench will open a Web Browser with the
License Download web page when you click Next. From there you will be able to download
your license as a file and import it. This option allows you to get a license, even though the
Workbench does not have direct access to the CLC Licenses Service.
If you select the first option, and it turns out that you do not have internet access from the
Workbench (because of a firewall, proxy server etc.), you will be able to click Previous and use
the other option instead.
Direct download
Selecting the first option takes you to the dialog shown in figure 1.3.
Figure 1.3: A license has been downloaded.
A progress for getting the license is shown, and when the license is downloaded, you will be able
to click Next.
Go to license download web page
Selecting the second option, Go to license download web page, opens the license web page as
shown in 1.4.
Click the Request Evaluation License button, and you will be able to save the license on your
computer, e.g. on the Desktop.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
18
Figure 1.4: The license web page where you can download a license.
Back in the Workbench window, you will now see the dialog shown in 1.5.
Figure 1.5: Importing the license downloaded from the web site.
Click the Choose License File button and browse to find the license file you saved before (e.g.
on your Desktop). When you have selected the file, click Next.
Accepting the license agreement
Regardless of which option you chose above, you will now see the dialog shown in figure 1.6.
Figure 1.6: Read the license agreement carefully.
Please read the License agreement carefully before clicking I accept these terms and Finish.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
1.4.2
19
Download a license
When you purchase a license, you will get a license ID from CLC bio. Using this option, you will
get a license based on this ID. When you have clicked Next, you will see the dialog shown in 1.7.
At the top, enter the ID (paste using Ctrl+V or + V on Mac).
Figure 1.7: Entering a license ID provided by CLC bio (the license ID in this example is artificial).
In this dialog, there are two options:
• Direct download. The workbench will attempt to contact the online CLC Licenses Service,
and download the license directly. This method requires internet access from the workbench.
• Go to license download web page. The workbench will open a Web Browser with the
License Download web page when you click Next. From there you will be able to download
your license as a file and import it. This option allows you to get a license, even though the
Workbench does not have direct access to the CLC Licenses Service.
If you select the first option, and it turns out that you do not have internet access from the
Workbench (because of a firewall, proxy server etc.), you will be able to click Previous and use
the other option instead.
Direct download
Selecting the first option takes you to the dialog shown in figure 1.8.
A progress for getting the license is shown, and when the license is downloaded, you will be able
to click Next.
Go to license download web page
Selecting the second option, Go to license download web page, opens the license web page as
shown in 1.9.
Click the Request Evaluation License button, and you will be able to save the license on your
computer, e.g. on the Desktop.
Back in the Workbench window, you will now see the dialog shown in 1.10.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
20
Figure 1.8: A license has been downloaded.
Figure 1.9: The license web page where you can download a license.
Figure 1.10: Importing the license downloaded from the web site.
Click the Choose License File button and browse to find the license file you saved before (e.g.
on your Desktop). When you have selected the file, click Next.
Accepting the license agreement
Regardless of which option you chose above, you will now see the dialog shown in figure 1.11.
Please read the License agreement carefully before clicking I accept these terms and Finish.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
21
Figure 1.11: Read the license agreement carefully.
1.4.3
Import a license from a file
If you are provided a license file instead of a license ID, you will be able to import the file using
this option.
When you have clicked Next, you will see the dialog shown in 1.12.
Figure 1.12: Selecting a license file .
Click the Choose License File button and browse to find the license file provided by CLC bio.
When you have selected the file, click Next.
Accepting the license agreement
Regardless of which option you chose above, you will now see the dialog shown in figure 1.13.
Please read the License agreement carefully before clicking I accept these terms and Finish.
1.4.4
Upgrade license
If you already have used a previous version of CLC Protein Workbench, and you are entitled to
upgrading to the new CLC Protein Workbench 5.8, select this option to get a license upgrade.
When you click Next, the workbench will search for a previous installation of CLC Protein
Workbench. It will then locate the old license.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
22
Figure 1.13: Read the license agreement carefully.
If the Workbench succeeds to find an existing license, the next dialog will look as shown in
figure 1.14.
Figure 1.14: An old license is detected.
When you click Next, the Workbench checks on CLC bio's web server to see if you are entitled to
upgrade your license.
Note! If you should be entitled to get an upgrade, and you do not get one automatically in this
process, please contact [email protected].
In this dialog, there are two options:
• Direct download. The workbench will attempt to contact the online CLC Licenses Service,
and download the license directly. This method requires internet access from the workbench.
• Go to license download web page. The workbench will open a Web Browser with the
License Download web page when you click Next. From there you will be able to download
your license as a file and import it. This option allows you to get a license, even though the
Workbench does not have direct access to the CLC Licenses Service.
If you select the first option, and it turns out that you do not have internet access from the
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
23
Workbench (because of a firewall, proxy server etc.), you will be able to click Previous and use
the other option instead.
Direct download
Selecting the first option takes you to the dialog shown in figure 1.15.
Figure 1.15: A license has been downloaded.
A progress for getting the license is shown, and when the license is downloaded, you will be able
to click Next.
Go to license download web page
Selecting the second option, Go to license download web page, opens the license web page as
shown in 1.16.
Figure 1.16: The license web page where you can download a license.
Click the Request Evaluation License button, and you will be able to save the license on your
computer, e.g. on the Desktop.
Back in the Workbench window, you will now see the dialog shown in 1.17.
Click the Choose License File button and browse to find the license file you saved before (e.g.
on your Desktop). When you have selected the file, click Next.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
24
Figure 1.17: Importing the license downloaded from the web site.
Accepting the license agreement
Regardless of which option you chose above, you will now see the dialog shown in figure 1.18.
Figure 1.18: Read the license agreement carefully.
Please read the License agreement carefully before clicking I accept these terms and Finish.
1.4.5
Configure license server connection
If your organization has installed a license server, you can use a floating license. The license
server has a set of licenses that can be used on all computers on the network. If the server has
e.g. 10 licenses, it means that maximum 10 computers can use a license simultaneously. When
you have selected this option and click Next, you will see the dialog shown in figure 1.19.
This dialog lets you specify how to connect to the license server:
• Connect to a license server. Check this option if you wish to use the license server.
• Automatically detect license server. By checking this option you do not have to enter more
information to connect to the server.
• Manually specify license server. There can be technical limitations which mean that the
license server cannot be detected automatically, and in this case you need to specify more
options manually:
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
25
Figure 1.19: Connecting to a license server.
Host name. Enter the address for the licenser server.
Port. Specify which port to use.
• Disable license borrowing on this computer. If you do not want users of the computer to
borrow a license (see section 1.4.5), you can check this option.
Borrow a license
A floating license can only be used when you are connected to the license server. If you wish
to use the CLC Protein Workbench when you are not connected to the server, you can borrow a
license. Borrowing a license means that you take one of the floating licenses available on the
server and borrow it for a specified amount of time. During this time period, there will be one
less floating license available on the server.
At the point where you wish to borrow a license, you have to be connected to the license server.
The procedure for borrowing is this:
1. Click Help | License Manager to display the dialog shown in figure 1.22.
2. Use the checkboxes to select the license(s) that you wish to borrow.
3. Select how long time you wish to borrow the license, and click Borrow Licenses.
4. You can now go offline and work with CLC Protein Workbench.
5. When the borrow time period has elapsed, you have to connect to the license server again
to use CLC Protein Workbench.
6. When the borrow time period has elapsed, the license server will make the floating license
available for other users.
Note that the time period is not the period of time that you actually use the Workbench.
Note! When your organization's license server is installed, license borrowing can be turned off.
In that case, you will not be able to borrow licenses.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
26
No license available...
If all the licenses on the server are in use, you will see a dialog as shown in figure 1.20 when
you start the Workbench.
Figure 1.20: No more licenses available on the server.
In this case, please contact your organization's license server administrator. To purchase
additional licenses, contact [email protected].
You can also click the Limited Mode button (see section 1.4.6).
If your connection to the license server is lost, you will see a dialog as shown in figure 1.21.
Figure 1.21: Unable to contact license server.
In this case, you need to make sure that you have access to the license server, and that the
server is running. However, there may be situations where you wish to use another license, or
see information about the license you currently use. In this case, open the license manager:
Help | License Manager (
)
The license manager is shown in figure 1.22.
Besides letting you borrow licenses (see section 1.4.5), this dialog can be used to:
• See information about the license (e.g. what kind of license, when it expires)
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
27
Figure 1.22: The license manager.
• Configure how to connect to a license server (Configure License Server the button at the
lower left corner). Clicking this button will display a dialog similar to figure 1.19.
• Upgrade from an evaluation license by clicking the Upgrade license button. This will display
the dialog shown in figure 1.1.
If you wish to switch away from using a floating license, click Configure License Server and
choose not to connect to a license server in the dialog. When you restart CLC Protein Workbench,
you will be asked for a license as described in section 1.4.
1.4.6
Limited mode
We have created the limited mode to prevent a situation where you are unable to access your
data because you do not have a license. When you run in limited mode, a lot of the tools in the
Workbench are not available, but you still have access to your data (also when stored in a CLC
Bioinformatics Database). When running in limited mode, the functionality is equivalent to the
CLC Sequence Viewer (see section A).
To get out of the limited mode and run the Workbench normally, restart the Workbench. When
you restart the Workbench will try to find a proper license and if it does, it will start up normally.
If it can't find a license, you will again have the option of running in limited mode.
1.5
About CLC Workbenches
In November 2005 CLC bio released two Workbenches: CLC Free Workbench and CLC Protein
Workbench. CLC Protein Workbench is developed from the free version, giving it the well-tested
user friendliness and look & feel. However, the CLC Protein Workbench includes a range of more
advanced analyses.
In March 2006, CLC DNA Workbench (formerly CLC Gene Workbench) and CLC Main Workbench
were added to the product portfolio of CLC bio. Like CLC Protein Workbench, CLC DNA Workbench
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
28
builds on CLC Free Workbench. It shares some of the advanced product features of CLC Protein
Workbench, and it has additional advanced features. CLC Main Workbench holds all basic and
advanced features of the CLC Workbenches.
In June 2007, CLC RNA Workbench was released as a sister product of CLC Protein Workbench
and CLC DNA Workbench. CLC Main Workbench now also includes all the features of CLC RNA
Workbench.
In March 2008, the CLC Free Workbench changed name to CLC Sequence Viewer.
In June 2008, the first version of the CLC Genomics Workbench was released due to an
extraordinary demand for software capable of handling sequencing data from the new highthroughput sequencing systems like 454, Illumina Genome Analyzer and SOLiD.
For an overview of which features all the applications include, see http://www.clcbio.com/
features.
In December 2006, CLC bio released a Software Developer Kit which makes it possible for
anybody with a knowledge of programming in Java to develop plug-ins. The plug-ins are fully
integrated with the CLC Workbenches and the Viewer and provide an easy way to customize and
extend their functionalities.
All our software will be improved continuously. If you are interested in receiving news about
updates, you should register your e-mail and contact data on http://www.clcbio.com, if you
haven't already registered when you downloaded the program.
1.5.1
New program feature request
The CLC team is continuously improving the CLC Protein Workbench with our users' interests
in mind. Therefore, we welcome all requests and feedback from users, and hope suggest new
features or more general improvements to the program on [email protected].
1.5.2
Report program errors
CLC bio is doing everything possible to eliminate program errors. Nevertheless, some errors
might have escaped our attention. If you discover an error in the program, you can use the
Report a Program Error function in the Help menu of the program to report it. In the Report a
Program Error dialog you are asked to write your e-mail address (optional). This is because we
would like to be able to contact you for further information about the error or for helping you with
the problem.
Note! No personal information is sent via the error report. Only the information which can be
seen in the Program Error Submission Dialog is submitted.
You can also write an e-mail to [email protected]. Remember to specify how the program error
can be reproduced.
All errors will be treated seriously and with gratitude.
We appreciate your help.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
29
Start in safe mode
If the program becomes unstable on start-up, you can start it in Safe mode. This is done by
pressing and holding down the Shift button while the program starts.
When starting in safe mode, the user settings (e.g. the settings in the Side Panel) are deleted
and cannot be restored. Your data stored in the Navigation Area is not deleted. When started in
safe mode, some of the functionalities are missing, and you will have to restart the CLC Protein
Workbench again (without pressing Shift).
1.5.3
CLC Sequence Viewer vs. Workbenches
The advanced analyses of the commercial workbenches, CLC Protein Workbench, CLC RNA
Workbench and CLC DNA Workbench are not present in CLC Sequence Viewer. Likewise, some
advanced analyses are available in CLC DNA Workbench but not in CLC RNA Workbench or CLC
Protein Workbench, and vice versa. All types of basic and advanced analyses are available in CLC
Main Workbench.
However, the output of the commercial workbenches can be viewed in all other workbenches.
This allows you to share the result of your advanced analyses from e.g. CLC Main Workbench,
with people working with e.g. CLC Sequence Viewer. They will be able to view the results of your
analyses, but not redo the analyses.
The CLC Workbenches and the CLC Sequence Viewer are developed for Windows, Mac and Linux
platforms. Data can be exported/imported between the different platforms in the same easy way
as when exporting/importing between two computers with e.g. Windows.
1.6
When the program is installed: Getting started
CLC Protein Workbench includes an extensive Help function, which can be found in the Help menu
of the program's Menu bar. The Help can also be shown by pressing F1. The help topics are
sorted in a table of contents and the topics can be searched.
We also recommend our Online presentations where a product specialist from CLC bio demonstrates our software. This is a very easy way to get started using the program. Read more about
online presentations here: http://clcbio.com/presentation.
1.6.1
Quick start
When the program opens for the first time, the background of the workspace is visible. In the
background are three quick start shortcuts, which will help you getting started. These can be
seen in figure 1.23.
Figure 1.23: Three available Quick start short cuts, available in the background of the workspace.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
30
The function of the three quick start shortcuts is explained here:
• Import data. Opens the Import dialog, which you let you browse for, and import data from
your file system.
• New sequence. Opens a dialog which allows you to enter your own sequence.
• Read tutorials. Opens the tutorials menu with a number of tutorials. These are also
available from the Help menu in the Menu bar.
1.6.2
Import of example data
It might be easier to understand the logic of the program by trying to do simple operations on
existing data. Therefore CLC Protein Workbench includes an example data set.
When downloading CLC Protein Workbench you are asked if you would like to import the example
data set. If you accept, the data is downloaded automatically and saved in the program. If you
didn't download the data, or for some other reason need to download the data again, you have
two options:
You can click Install Example Data ( ) in the Help menu of the program. This installs the data
automatically. You can also go to http://www.clcbio.com/download and download the
example data from there.
If you download the file from the website, you need to import it into the program. See chapter
7.1 for more about importing data.
1.7
Plug-ins
When you install CLC Protein Workbench, it has a standard set of features. However, you can
upgrade and customize the program using a variety of plug-ins.
As the range of plug-ins is continuously updated and expanded, they will not be listed here. Instead
we refer to http://www.clcbio.com/plug-ins for a full list of plug-ins with descriptions of
their functionalities.
1.7.1
Installing plug-ins
Plug-ins are installed using the plug-in manager2 :
Help in the Menu Bar | Plug-ins and Resources... (
or Plug-ins (
)
) in the Toolbar
The plug-in manager has four tabs at the top:
• Manage Plug-ins. This is an overview of plug-ins that are installed.
• Download Plug-ins. This is an overview of available plug-ins on CLC bio's server.
2
In order to install plug-ins on Windows Vista, the Workbench must be run in administrator mode: Right-click the
program shortcut and choose "Run as Administrator". Then follow the procedure described below.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
31
• Manage Resources. This is an overview of resources that are installed.
• Download Resources. This is an overview of available resources on CLC bio's server.
To install a plug-in, click the Download Plug-ins tab. This will display an overview of the plug-ins
that are available for download and installation (see figure 1.24).
Figure 1.24: The plug-ins that are available for download.
Clicking a plug-in will display additional information at the right side of the dialog. This will also
display a button: Download and Install.
Click the plug-in and press Download and Install. A dialog displaying progress is now shown, and
the plug-in is downloaded and installed.
If the plug-in is not shown on the server, and you have it on your computer (e.g. if you have
downloaded it from our web-site), you can install it by clicking the Install from File button at the
bottom of the dialog. This will open a dialog where you can browse for the plug-in. The plug-in file
should be a file of the type ".cpa".
When you close the dialog, you will be asked whether you wish to restart the CLC Protein
Workbench. The plug-in will not be ready for use before you have restarted.
1.7.2
Uninstalling plug-ins
Plug-ins are uninstalled using the plug-in manager:
Help in the Menu Bar | Plug-ins and Resources... (
or Plug-ins (
) in the Toolbar
This will open the dialog shown in figure 1.25.
The installed plug-ins are shown in this dialog. To uninstall:
)
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
32
Figure 1.25: The plug-in manager with plug-ins installed.
Click the plug-in | Uninstall
If you do not wish to completely uninstall the plug-in but you don't want it to be used next time
you start the Workbench, click the Disable button.
When you close the dialog, you will be asked whether you wish to restart the workbench. The
plug-in will not be uninstalled before the workbench is restarted.
1.7.3
Updating plug-ins
If a new version of a plug-in is available, you will get a notification during start-up as shown in
figure 1.26.
In this list, select which plug-ins you wish to update, and click Install Updates. If you press
Cancel you will be able to install the plug-ins later by clicking Check for Updates in the Plug-in
manager (see figure 1.25).
1.7.4
Resources
Resources are downloaded, installed, un-installed and updated the same way as plug-ins. Click
the Download Resources tab at the top of the plug-in manager, and you will see a list of available
resources (see figure 1.27).
Currently, the only resources available are PFAM databases (for use with CLC Protein Workbench
and CLC Main Workbench).
Because procedures for downloading, installation, uninstallation and updating are the same as
for plug-ins see section 1.7.1 and section 1.7.2 for more information.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
33
Figure 1.26: Plug-in updates.
Figure 1.27: Resources available for download.
1.8
Network configuration
If you use a proxy server to access the Internet you must configure CLC Protein Workbench to use
this. Otherwise you will not be able to perform any online activities (e.g. searching GenBank).
CLC Protein Workbench supports the use of a HTTP-proxy and an anonymous SOCKS-proxy.
To configure your proxy settings, open CLC Protein Workbench, and go to the Advanced-tab of the
Preferences dialog (figure 1.28) and enter the appropriate information. The Preferences dialog
is opened from the Edit menu.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
34
Figure 1.28: Adjusting proxy preferences.
You have the choice between a HTTP-proxy and a SOCKS-proxy. CLC Protein Workbench only
supports the use of a SOCKS-proxy that does not require authorization.
Exclude hosts can be used if there are some hosts that should be contacted directly and not
through the proxy server. The value can be a list of hosts, each separated by a |, and in addition
a wildcard character * can be used for matching. For example: *.foo.com|localhost.
If you have any problems with these settings you should contact your systems administrator.
1.9
The format of the user manual
This user manual offers support to Windows, Mac OS X and Linux users. The software is very
similar on these operating systems. In areas where differences exist, these will be described
separately. However, the term "right-click" is used throughout the manual, but some Mac users
may have to use Ctrl+click in order to perform a "right-click" (if they have a single-button mouse).
The most recent version of the user manuals can be downloaded from http://www.clcbio.
com/usermanuals.
The user manual consists of four parts.
• The first part includes the introduction and some tutorials showing how to apply the most
significant functionalities of CLC Protein Workbench.
• The second part describes in detail how to operate all the program's basic functionalities.
• The third part digs deeper into some of the bioinformatic features of the program. In this
part, you will also find our "Bioinformatics explained" sections. These sections elaborate on
the algorithms and analyses of CLC Protein Workbench and provide more general knowledge
of bioinformatic concepts.
• The fourth part is the Appendix and Index.
Each chapter includes a short table of contents.
CHAPTER 1. INTRODUCTION TO CLC PROTEIN WORKBENCH
1.9.1
35
Text formats
In order to produce a clearly laid-out content in this manual, different formats are applied:
• A feature in the program is in bold starting with capital letters. ( Example: Navigation Area)
• An explanation of how a particular function is activated, is illustrated by "|" and bold. (E.g.:
select the element | Edit | Rename)
Chapter 2
Tutorials
Contents
2.1
2.2
2.3
2.4
2.5
2.6
2.7
2.8
Tutorial: Getting started . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.1.1
Creating a a folder . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.1.2
Import data
38
38
. . . . . . . . . . . . . . . . . . . . . . . . . . . . .
38
Tutorial: Side Panel Settings . . . . . . . . . . . . . . . . . . . . . . . . . . .
2.3.1
Saving the settings in the Side Panel . . . . . . . . . . . . . . . . . . . .
40
42
2.3.2
Applying saved settings . . . . . . . . . . . . . . . . . . . . . . . . . . .
43
Tutorial: GenBank search and download . . . . . . . . . . . . . . . . . . . . .
43
2.4.1
Searching for matching objects . . . . . . . . . . . . . . . . . . . . . . .
2.4.2
Saving the sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . .
44
Tutorial: BLAST search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
44
44
2.5.1
Performing the BLAST search . . . . . . . . . . . . . . . . . . . . . . . .
45
2.5.2
Inspecting the results . . . . . . . . . . . . . . . . . . . . . . . . . . . .
46
2.5.3
Using the BLAST table view . . . . . . . . . . . . . . . . . . . . . . . . .
47
Tutorial: Tips for specialized BLAST searches . . . . . . . . . . . . . . . . . .
47
2.6.1
Locate a protein sequence on the chromosome . . . . . . . . . . . . . .
48
2.6.2
BLAST for primer binding sites . . . . . . . . . . . . . . . . . . . . . . .
50
2.6.3
Finding remote protein homologues
. . . . . . . . . . . . . . . . . . . .
51
2.6.4
Further reading . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
51
Tutorial: Proteolytic cleavage detection . . . . . . . . . . . . . . . . . . . . .
52
Tutorial: Align protein sequences . . . . . . . . . . . . . . . . . . . . . . . .
54
2.8.1
2.9
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Tutorial: View sequence
37
The alignment dialog . . . . . . . . . . . . . . . . . . . . . . . . . . . .
Tutorial: Create and modify a phylogenetic tree
54
. . . . . . . . . . . . . . . .
56
Tree layout . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
56
2.10 Tutorial: Find restriction sites . . . . . . . . . . . . . . . . . . . . . . . . . .
57
2.9.1
2.10.1
The Side Panel way of finding restriction sites . . . . . . . . . . . . . . .
57
2.10.2
The Toolbox way of finding restriction sites
58
36
. . . . . . . . . . . . . . . .
CHAPTER 2. TUTORIALS
37
This chapter contains tutorials representing some of the features of CLC Protein Workbench. The
first tutorials are meant as a short introduction to operating the program. The last tutorials give
examples of how to use some of the main features of CLC Protein Workbench.
tutorials at http://www.clcbio.com/tutorials.
2.1
Watch video
Tutorial: Getting started
This brief tutorial will take you through the most basic steps of working with CLC Protein
Workbench. The tutorial introduces the user interface, shows how to create a folder, and
demonstrates how to import your own existing data into the program.
When you open CLC Protein Workbench for the first time, the user interface looks like figure 2.1.
Figure 2.1: The user interface as it looks when you start the program for the first time. (Windows
version of CLC Protein Workbench. The interface is similar for Mac and Linux.)
At this stage, the important issues are the Navigation Area and the View Area.
The Navigation Area to the left is where you keep all your data for use in the program. Most
analyses of CLC Protein Workbench require that the data is saved in the Navigation Area. There
are several ways to get data into the Navigation Area, and this tutorial describes how to import
existing data.
The View Area is the main area to the right. This is where the data can be 'viewed'. In general,
CHAPTER 2. TUTORIALS
38
a View is a display of a piece of data, and the View Area can include several Views. The Views
are represented by tabs, and can be organized e.g. by using 'drag and drop'.
2.1.1
Creating a a folder
When CLC Protein Workbench is started there is one element in the Navigation Area called
CLC_Data1 . This element is a Location. A location points to a folder on your computer where
your data for use with CLC Protein Workbench is stored.
The data in the location can be organized into folders. Create a folder:
File | New | Folder ( )
or Ctrl + Shift + N ( + Shift + N on Mac)
Name the folder 'My folder' and press Enter.
2.1.2
Import data
Next, we want to import a sequence called HUMDINUC.fsa (FASTA format) from our own Desktop
into the new 'My folder'. (This file is chosen for demonstration purposes only - you may have
another file on your desktop, which you can use to follow this tutorial. You can import all kinds
of files.)
In order to import the HUMDINUC.fsa file:
Select 'My folder' | Import (
desktop | Select
) in the Toolbar | navigate to HUMDINUC.fsa on the
The sequence is imported into the folder that was selected in the Navigation Area, before you
clicked Import. Double-click the sequence in the Navigation Area to view it. The final result looks
like figure 2.2.
2.2
Tutorial: View sequence
This brief tutorial will take you through some different ways to display a sequence in the program.
The tutorial introduces zooming on a sequence, dragging tabs, and opening selection in new
view.
We will be working with the sequence called pcDNA3-atp8a1 located in the 'Cloning' folder in the
Example data. Double-click the sequence in the Navigation Area to open it. The sequence is
displayed with annotations above it. (See figure 2.3).
As default, CLC Protein Workbench displays a sequence with annotations (colored arrows on
the sequence like the green promoter region annotation in figure 2.3) and zoomed to see the
residues.
In this tutorial we want to have an overview of the whole sequence. Hence;
click Zoom Out (
sequence
1
) in the Toolbar | click the sequence until you can see the whole
If you have downloaded the example data, this will be placed as a folder in CLC_Data
CHAPTER 2. TUTORIALS
39
Figure 2.2: The HUMDINUC file is imported and opened.
Figure 2.3: Sequence pcDNA3-atp8a1 opened in a view.
This sequence is circular, which is indicated by << and >> at the beginning and the end of the
sequence.
In the following we will show how the same sequence can be displayed in two different views one linear view and one circular view. First, zoom in to see the residues again by using the Zoom
In ( ) or the 100% ( ). Then we make a split view by:
press and hold the Ctrl-button on the keyboard (
( ) at the bottom of the view
on Mac) | click Show as Circular
CHAPTER 2. TUTORIALS
40
This opens an additional view of the vector with a circular display, as can be seen in figure 2.4.
Figure 2.4: The resulting two views which are split horizontally.
Make a selection on the circular sequence (remember to switch to the Selection (
tool bar) and note that this selection is also reflected in the linear view above.
2.3
) tool in the
Tutorial: Side Panel Settings
This brief tutorial will show you how to use the Side Panel to change the way your sequences,
alignments and other data are shown. You will also see how to save the changes that you made
in the Side Panel .
Open the protein alignment located under Protein orthologs in the Example data. The initial
view of the alignment has colored the residues according to the Rasmol color scheme, and the
alignment is automatically wrapped to fit the width of the view (shown in figure 2.5).
Now, we are going to modify how this alignment is displayed. For this, we use the settings in
the Side Panel to the right. All the settings are organized into groups, which can be expanded
/ collapsed by clicking the name of the group. The first group is Sequence Layout which is
expanded by default.
CHAPTER 2. TUTORIALS
41
Figure 2.5: The protein alignment as it looks when you open it with background color according to
the Rasmol color scheme and automatically wrapped.
First, select No wrap in the Sequence Layout. This means that each sequence in the alignment
is kept on the same line. To see more of the alignment, you now have to scroll horizontally.
Next, expand the Annotation Layout group and select Show Annotations. Set the Offset to
"More offset" and set the Label to "Stacked".
Expand the Annotation Types group. Here you will see a list of the types annotation that are
carried by the sequences in the alignment (see figure 2.6).
Figure 2.6: The Annotation Layout and the Annotation Types in the Side Panel.
Check the "Region" annotation type, and you will see the regions as red annotations on the
CHAPTER 2. TUTORIALS
42
sequences.
Next, we will change the way the residues are colored. Click the Alignment Info group and under
Conservation, check "Background color". This will use a gradient as background color for the
residues. You can adjust the coloring by dragging the small arrows above the color box.
2.3.1
Saving the settings in the Side Panel
Now the alignment should look similar to figure 2.7.
Figure 2.7: The alignment when all the above settings have been changed.
At this point, if you just close the view, the changes made to the Side Panel will not be saved.
This means that you would have to perform the changes again next time you open the alignment.
To save the changes to the Side Panel, click the Save/Restore Settings button ( ) at the top
of the Side Panel and click Save Settings (see figure 2.8).
Figure 2.8: Saving the settings of the Side Panel.
This will open the dialog shown in figure 2.9.
Figure 2.9: Dialog for saving the settings of the Side Panel.
In this way you can save the current state of the settings in the Side Panel so that you can apply
CHAPTER 2. TUTORIALS
43
them to alignments later on. If you check Always apply these settings, these settings will be
applied every time you open a view of the alignment.
Type "My settings" in the dialog and click Save.
2.3.2
Applying saved settings
When you click the Save/Restore Settings button ( ) again and select Apply Saved Settings,
you will see "My settings" in the menu together with some pre-defined settings that the CLC
Protein Workbench has created for you (see figure 2.10).
Figure 2.10: Menu for applying saved settings.
Whenever you open an alignment, you will be able to apply these settings. Each kind of view has
its own list of settings that can be applied.
At the bottom of the list you will see the "CLC Standard Settings" which are the default settings
for the view.
2.4
Tutorial: GenBank search and download
The CLC Protein Workbench allows you to search the NCBI GenBank database directly from the
program, giving you the opportunity to both open, view, analyze and save the search results
without using any other applications. To conduct a search in NCBI GenBank from CLC Protein
Workbench you must be connected to the Internet.
This tutorial shows how to find a complete human hemoglobin DNA sequence in a situation where
you do not know the accession number of the sequence.
To start the search:
Search | Search for Sequences at NCBI (
)
This opens the search view. We are searching for a DNA sequence, hence:
Nucleotide
Now we are going to adjust parameters for the search. By clicking Add search parameters you
activate an additional set of fields where you can enter search criteria. Each search criterion
consists of a drop down menu and a text field. In the drop down menu you choose which part of
the NCBI database to search, and in the text field you enter what to search for:
CHAPTER 2. TUTORIALS
44
Click Add search parameters until three search criteria are available | choose
Organism in the first drop down menu | write 'human' in the adjoining text field |
choose All Fields in the second drop down menu | write 'hemoglobin' in the adjoining
text field | choose All Fields in the third drop down menu | write 'complete' in the
adjoining text field
Figure 2.11: NCBI search view.
Click Start search (
2.4.1
) to commence the search in NCBI.
Searching for matching objects
When the search is complete, the list of hits is shown. If the desired complete human hemoglobin
DNA sequence is found, the sequence can be viewed by double-clicking it in the list of hits from
the search. If the desired sequence is not shown, you can click the 'More' button below the list
to see more hits.
2.4.2
Saving the sequence
The sequences which are found during the search can be displayed by double-clicking in the list
of hits. However, this does not save the sequence. You can save one or more sequence by
selecting them and:
click Download and Save
or drag the sequences into the Navigation Area
2.5
Tutorial: BLAST search
BLAST is an invaluable tool in bioinformatics. It has become central to identification of
homologues and similar sequences, and can also be used for many other different purposes.
This tutorial takes you through the steps of running a blast search in CLC Workbenches. If
you plan to use blast for your research, we highly recommend that you read further about it.
Understanding how blast works is key to setting up meaningful and efficient searches.
CHAPTER 2. TUTORIALS
45
Suppose you are working with the ATP8a1 protein sequence which is a phospholipid-transporting
ATPase expressed in the adult house mouse, Mus musculus. To obtain more information
about this molecule you wish to query the peptides held in the Swiss-Prot* database to find
homologous proteins in humans Homo sapiens, using the Basic Local Alignment Search Tool
(BLAST) algorithm.
This tutorial involves running BLAST remotely using databases housed at the NCBI. Your computer
must be connected to the internet to complete this tutorial.
2.5.1
Performing the BLAST search
Start out by:
select protein ATP8a1 | Toolbox | BLAST Search (
) | NCBI BLAST (
)
In Step 1 you can choose which sequence to use as query sequence. Since you have already
chosen the sequence it is displayed in the Selected Elements list.
Click Next.
In Step 2 (figure 2.12), choose the default BLAST program: blastp: Protein sequence and
database and select the Swiss-Prot database in the Database drop down menu.
Figure 2.12: Choosing BLAST program and database.
Click Next.
In the Limit by Entrez query in Step 3, choose Homo sapiens[ORGN] from the drop down menu
to arrive at the search configuration seen in figure 2.13. Including this term limits the query to
proteins of human origin.
Choose to Open your results.
Click Finish to accept the parameter settings and begin the BLAST search.
The computer now contacts NCBI and places your query in the BLAST search queue. After a short
while the result should be received and opened in a new view.
CHAPTER 2. TUTORIALS
46
Figure 2.13: The BLAST search is limited to homo sapiens[ORGN]. The remaining parameters are
left as default.
2.5.2
Inspecting the results
The output is shown in figure 2.14 and consists of a list of potential homologs that are sorted by
their BLAST match-score and shown in descending order below the query sequence.
Figure 2.14: Output of a BLAST search. By holding the mouse pointer over the lines you can get
information about the sequence.
Try placing your mouse cursor over a potential homologous sequence. You will see that a context
box appears containing information about the sequence and the match-scores obtained from the
BLAST algorithm.
The lines in the BLAST view are the actual sequences which are downloaded. This means that
you can zoom in and see the actual alignment:
Zoom in in the Tool Bar (
see the residues
) | Click in the BLAST view a number of times until you
CHAPTER 2. TUTORIALS
47
Now we will focus our attention on sequence Q9Y2Q0 - the BLAST hit that is at the top of the
list. To download the full sequence:
right-click the line representing sequence Q9Y2Q0 | Download Full Hit Sequence
from NCBI
This opens the sequence. However, the sequence is not saved yet. Drag and drop the sequence
into the Navigation Area to save it. This homologous sequence is now stored in the CLC Protein
Workbench and you can use it to gain information about the query sequence by using the various
tools of the workbench, e.g. by studying its textual information, by studying its annotation or by
aligning it to the query sequence.
2.5.3
Using the BLAST table view
As an alternative to the graphic BLAST view, you can click the Table View (
This will display a tabular view of the BLASt hits as shown in figure 2.15.
) at the bottom.
Figure 2.15: Output of a BLAST search shown in a table.
This view provides more statistics about the hits, and you can use the filter to search for e.g.
a specific type of protein etc. If you wish to download several of the hit sequences, this is
easily done in this view. Simply select the relevant sequences and drag them into a folder in the
Navigation Area.
2.6
Tutorial: Tips for specialized BLAST searches
Here, you will learn how to:
• Use BLAST to find the gene coding for a protein in a genomic sequence.
• Find primer binding sites on genomic sequences
• Identify remote protein homologues.
Following through these sections of the tutorial requires some experience using the Workbench,
so if you get stuck at some point, we recommend going through the more basic tutorials first.
CHAPTER 2. TUTORIALS
2.6.1
48
Locate a protein sequence on the chromosome
If you have a protein sequence but want to see the actual location on the chromosome this is
easy to do using BLAST.
In this example we wish to map the protein sequence of the Human beta-globin protein to a
chromosome. We know in advance that the beta-globin is located somewhere on chromosome
11.
Data used in this example can be downloaded from GenBank:
Search | Search for Sequences at NCBI (
)
Human chromosome 11 (NC_000011) consists of 134452384 nucleotides and the beta-globin
(AAA16334) protein has 147 amino acids.
BLAST configuration
Next, conduct a local BLAST search:
Toolbox | BLAST Search (
) | Local BLAST (
)
Select the protein sequence as query sequence and click Next. Since you wish to BLAST a
protein sequence against a nucleotide sequence, use tblastn which will automatically translate
the nucleotide sequence selected as database.
As Target select NC_000011 that you downloaded. If you are used to BLAST, you will know that
you usually have to create a BLAST database before BLASTing, but the Workbench does this "on
the fly" when you just select one or more sequences.
Click Next, leave the parameters at their default, click Next again, and then Finish.
Inspect BLAST result
When the BLAST result appears make a split view so that both the table and graphical view is
visible (see figure 2.16). This is done by pressing Ctrl ( on Mac) while clicking the table view
( ) at the bottom of the view.
In the table start out by showing two additional columns; "% Positive" and "Query start". These
should simply be checked in the Side Panel.
Now, sort the BLAST table view by clicking the column header "% Positive". Then, press and hold
the Ctrl button ( on Mac) and click the header "Query start". Now you have sorted the table
first on % Positive hits and then the start position of the query sequence. Now you see that you
actually have three regions with a 100% positive hit but at different locations on the chromosome
sequence (see figure 2.16).
Why did we find, on the protein level, three identical regions between our query protein sequence
and nucleotide database?
The beta-globin gene is known to have three exons and this is exactly what we find in the BLAST
search. Each translated exon will hit the corresponding sequence on the chromosome.
If you place the mouse cursor on the sequence hits in the graphical view, you can see the reading
frame which is -1, -2 and -3 for the three hits, respectively.
CHAPTER 2. TUTORIALS
49
Figure 2.16: Placement of translated nucleotide sequence hits on the Human beta-globin.
Verify the result
Open NC_000011 in a view, and go to the Hit start position (5,204,729) and zoom to see
the blue gene annotation. You can now see the exon structure of the Human beta-globin gene
showing the three exons on the reverse strand (see figure 2.17).
Figure 2.17: Human beta-globin exon view.
If you wish to verify the result, make a selection covering the gene region and open it in a new
view:
right-click | Open Selection in New View (
) | Save (
Save the sequence, and perform a new BLAST search:
)
CHAPTER 2. TUTORIALS
50
• Use the new sequence as query.
• Use BLASTx
• Use the protein sequence, AAA16334, as database
Using the genomic sequence as query, the mapping of the protein sequence to the exons is
visually very clear as shown in figure 2.18.
Figure 2.18: Verification of the result: at the top a view of the whole BLAST result. At the bottom
the same view is zoomed in on exon 3 to show the amino acids.
In theory you could use the chromosome sequence as query, but the performance would not be
optimal: it would take a long time, and the computer might run out of memory.
In this example, you have used well-annotated sequences where you could have searched for
the name of the gene instead of using BLAST. However, there are other situations where you
either do not know the name of the gene, or the genomic sequence is poorly annotated. In these
cases, the approach described in this tutorial can be very productive.
2.6.2
BLAST for primer binding sites
You can adjust the BLAST parameters so it becomes possible to match short primer sequences
against a larger sequence. Then it is easy to examine whether already existing lab primers can
CHAPTER 2. TUTORIALS
51
be reused for other purposes, or if the primers you designed are specific.
Purpose
Standard BLAST
Primer search
Program
blastn
blastn
Word size
11
7
Low complexity filter
On
Off
Expect value
10
1000
These settings are shown in figure 2.19.
Figure 2.19: Settings for searching for primer binding sites.
2.6.3
Finding remote protein homologues
If you look for short identical peptide sequences in a database, the standard BLAST parameters will have to be reconfigured. Using the parameters described below, you are likely
to be able to identify whether antigenic determinants will cross react to other proteins.
Purpose
Program Word size Low complexity filter Expect value Scoring matrix
Standard BLAST
blastp
3
On
10
BLSUM62
Remote homologues blastp
2
Off
20000
PAM30
These settings are shown in figure 2.20.
2.6.4
Further reading
A valuable source of information about BLAST can be found at http://blast.ncbi.nlm.nih.
gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&DOC_TYPE=ProgSelectionGuide.
Remember that BLAST is a heuristic method. This means that certain assumptions are made to
allow searches to be done in a reasonable amount of time. Thus you cannot trust BLAST search
results to be accurate. For very accurate results you should consider using other algorithms, such
as Smith-Waterman. You can read "Bioinformatics explained: BLAST versus Smith-Waterman"
here: http://www.clcbio.com/BE.
CHAPTER 2. TUTORIALS
52
Figure 2.20: Settings for searching for remote homologues.
2.7
Tutorial: Proteolytic cleavage detection
This tutorial shows you how to find cut sites and see an overview of fragments when cleaving
proteins with proteolytic cleavage enzymes.
Suppose you are working with protein ATP8a1 from the example data, and you wish to see where
the enzyme trypsin will cleave the protein. Furthermore, you want to see details for the resulting
fragments which are between 10 and 15 amino acids long.
select protein ATP8a1 | Toolbox | Protein Analyses (
) | Proteolytic Cleavage
This opens Step 1 of the Proteolytic Cleavage dialog. In this step you can choose which
sequences to include in the analysis. Since you have already chosen ATP8a1, click Next.
In this step you should select Trypsin. This is illustrated in figure 2.21.
Figure 2.21: Selecting trypsin as the cleaving enzyme.
Click Next to go to Step 3 of the dialog.
CHAPTER 2. TUTORIALS
53
In Step 3 you can adjust the parameters for which fragments of the cleavage you want to include
in the table output of the analysis.
Type '10' in the Min. fragment length | Check the box: Max. fragment length |
enter '15' in the corresponding text field
These parameter adjustments are shown in figure 2.22:
Figure 2.22: Adjusting the output from the cleavage to include fragments which are between 10
and 15 amino acids long.
Click Finish to make the analysis. The result of the analysis can be seen in figure 2.23
Figure 2.23: The output of the proteolytic cleavage shows the cleavage sites as annontations in
the protein sequence. The accompanying table lists all the fragments which are between 10 and
15 amino acids long.
Note! The output of proteolytic cleavage is two related views. The sequence view displays
annotations where the sequence is cleaved. The table view shows information about the
fragments satisfying the parameters set in the dialog. Subsequently, if you have restricted the
fragment parameters, you might have more annotations on the sequence than fragments in the
CHAPTER 2. TUTORIALS
54
table.
If you conduct another proteolytic cleavage on the same sequence, the output consists of:
(possibly) new annotations on the original sequence and an additional table view, listing all
fragments.
2.8
Tutorial: Align protein sequences
This tutorial outlines some of the alignment functionality of the CLC Protein Workbench. In
addition to creating alignments of nucleotide or peptide sequences, the software offers several
ways to view alignments. The alignments can then be used for building phylogenetic trees.
Sequences must be available via the Navigation Area to be included in an alignment. If you have
sequences open in a View that you have not saved, then you just need to select the view tab and
press Ctrl + S (or + S on Mac) to save them.
In this tutorial six protein sequences from the Example data folder will be aligned.
figure 2.24).
(See
Figure 2.24: Six protein sequences in 'Sequences' from the 'Protein orthologs' folder of the Example
data.
To align the sequences:
select the sequences from the 'Protein' folder under 'Sequences' | Toolbox |
Alignments and Trees ( ) | Create Alignment ( )
2.8.1
The alignment dialog
This opens the dialog shown in figure 2.25.
Figure 2.25: The alignment dialog displaying the six protein sequences.
CHAPTER 2. TUTORIALS
55
It is possible to add and remove sequences from Selected Elements list. Since we had already
selected the eight proteins, just click Next to adjust parameters for the alignment.
Clicking Next opens the dialog shown in figure 2.26.
Figure 2.26: The alignment dialog displaying the available parameters which can be adjusted.
Leave the parameters at their default settings. An explanation of the parameters can be found
by clicking the help button ( ). Alternatively, a tooltip is displayed by holding the mouse cursor
on the parameters.
Click Finish to start the alignment process which is shown in the Toolbox under the Processes
tab. When the program is finished calculating it displays the alignment (see fig. 2.27):
Figure 2.27: The resulting alignment.
Note! The new alignment is not saved automatically.
To save the alignment, drag the tab of the alignment view into the Navigation Area.
Installing the Additional Alignments plugin gives you access to other alignment algorithms:
ClustalW (Windows/Mac/Linux), Muscle (Windows/Mac/Linux), T-Coffee (Mac/Linux), MAFFT
(Mac/Linux), and Kalign (Mac/Linux). The Additional Alignments Module can be downloaded from
http://www.clcbio.com/plugins. Note that you will need administrative privileges on your
CHAPTER 2. TUTORIALS
56
system to install it.
2.9
Tutorial: Create and modify a phylogenetic tree
You can make a phylogenetic tree from an existing alignment. (See how to create an alignment
in the tutorial: "Align protein sequences").
We use the 'ATPase protein alignment' located in 'Protein orthologs' in the Example data. To
create a phylogenetic tree:
click the 'ATPase protein alignment' in the Navigation Area | Toolbox | Alignments
and Trees ( ) | Create Tree ( )
A dialog opens where you can confirm your selection of the alignment. Click Next to move to
the next step in the dialog where you can choose between the neighbor joining and the UPGMA
algorithms for making trees. You also have the option of including a bootstrap analysis of the
result. Leave the parameters at their default, and click Finish to start the calculation, which can
be seen in the Toolbox under the Processes tab. After a short while a tree appears in the View
Area (figure 2.28).
Figure 2.28: After choosing which algorithm should be used, the tree appears in the View Area.
The Side panel in the right side of the view allows you to adjust the way the tree is displayed.
2.9.1
Tree layout
Using the Side Panel (in the right side of the view), you can change the way the tree is displayed.
Click Tree Layout and open the Layout drop down menu. Here you can choose between standard
and topology layout. The topology layout can help to give an overview of the tree if some of the
branches are very short.
When the sequences include the appropriate annotation, it is possible to choose between the
accession number and the species names at the leaves of the tree. Sequences downloaded
from GenBank, for example, have this information. The Labels preferences allows these different
node annotations as well as different annotation on the branches.
The branch annotation includes the bootstrap value, if this was selected when the tree was
calculated. It is also possible to annotate the branches with their lengths.
CHAPTER 2. TUTORIALS
2.10
57
Tutorial: Find restriction sites
This tutorial will show you how to find restriction sites and annotate them on a sequence.
There are two ways of finding and showing restriction sites. In many cases, the dynamic restriction
sites found in the Side Panel of sequence views will be useful, since it is a quick and easy way
of showing restriction sites. In the Toolbox you will find the other way of doing restriction site
analyses. This way provides more control of the analysis and gives you more output options, e.g.
a table of restriction sites and a list of restriction enzymes that can be saved for later use. In this
tutorial, the first section describes how to use the Side Panel to show restriction sites, whereas
the second section describes the restriction map analysis performed from the Toolbox.
2.10.1
The Side Panel way of finding restriction sites
When you open a sequence, there is a Restriction sites setting in the Side Panel. By default, 10
of the most popular restriction enzymes are shown (see figure 2.29).
Figure 2.29: Showing restriction sites of ten restriction enzymes.
The restriction sites are shown on the sequence with an indication of cut site and recognition
sequence. In the list of enzymes in the Side Panel, the number of cut sites is shown in
parentheses for each enzyme (e.g. SalI cuts three times). If you wish to see the recognition
sequence of the enzyme, place your mouse cursor on the enzyme in the list for a short moment,
and a tool tip will appear.
You can add or remove enzymes from the list by clicking the Manage enzymes button.
CHAPTER 2. TUTORIALS
2.10.2
58
The Toolbox way of finding restriction sites
Suppose you are working with sequence 'ATP8a1 mRNA' from the example data, and you wish to
know which restriction enzymes will cut this sequence exactly once and create a 3' overhang. Do
the following:
select the ATP8a1 mRNA | Toolbox in the Menu Bar | Restriction Sites (
Restriction Site Analysis ( )
) |
Click Next to set parameters for the restriction map analysis.
In this step first select Use existing enzyme list and click the Browse for enzyme list button
( ). Select the 'Popular enzymes' in the Cloning folder under Enzyme lists.
Then write 3' into the filter below to the left. Select all the enzymes and click the Add button
( ). The result should be like in figure 2.30.
Figure 2.30: Selecting enzymes.
Click Next. In this step you specify that you want to show enzymes that cut the sequence only
once. This means that you should de-select the Two restriction sites checkbox.
Click Next and select that you want to Add restriction sites as annotations on sequence and
Create restriction map. (See figure 2.31).
Figure 2.31: Selecting output for restriction map analysis.
Click Finish to start the restriction map analysis.
CHAPTER 2. TUTORIALS
59
View restriction site
The restriction sites are shown in two views: one view is in a tabular format and the other view
displays the sites as annotations on the sequence.
The result is shown in figure 2.32.
The restriction map at the bottom can also be shown as a
Figure 2.32: The result of the restriction map analysis is displayed in a table at the bottom and as
annotations on the sequence in the view at the top.
table of fragments produced by cutting the sequence with the enzymes:
Click the Fragments button (
) at the bottom of the view
In a similar way the fragments can be shown on a virtual gel:
Click the Gel button (
) at the bottom of the view
Part II
Core Functionalities
60
Chapter 3
User interface
Contents
3.1
3.2
3.3
3.4
3.5
Navigation Area . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
62
3.1.1
Data structure . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
63
3.1.2
Create new folders
. . . . . . . . . . . . . . . . . . . . . . . . . . . . .
65
3.1.3
Sorting folders . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
65
3.1.4
3.1.5
Multiselecting elements . . . . . . . . . . . . . . . . . . . . . . . . . . .
Moving and copying elements . . . . . . . . . . . . . . . . . . . . . . . .
65
65
3.1.6
Change element names . . . . . . . . . . . . . . . . . . . . . . . . . . .
67
3.1.7
Delete elements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
68
3.1.8
Show folder elements in a table . . . . . . . . . . . . . . . . . . . . . .
68
View Area . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
69
3.2.1
Open view . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
70
3.2.2
Show element in another view . . . . . . . . . . . . . . . . . . . . . . .
71
3.2.3
Close views . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
71
3.2.4
Save changes in a view . . . . . . . . . . . . . . . . . . . . . . . . . . .
72
3.2.5
Undo/Redo
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
72
3.2.6
Arrange views in View Area . . . . . . . . . . . . . . . . . . . . . . . . .
73
3.2.7
Side Panel . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
75
Zoom and selection in View Area . . . . . . . . . . . . . . . . . . . . . . . .
76
3.3.1
Zoom In . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
76
3.3.2
Zoom Out . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
76
3.3.3
Fit Width . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
77
3.3.4
Zoom to 100%
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
77
3.3.5
Move . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
77
3.3.6
Selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
77
3.3.7
Changing compactness . . . . . . . . . . . . . . . . . . . . . . . . . . .
77
Toolbox and Status Bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
78
3.4.1
Processes . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
78
3.4.2
Toolbox . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
79
3.4.3
Status Bar . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
79
Workspace . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
79
61
CHAPTER 3. USER INTERFACE
3.5.1
3.5.2
3.5.3
3.6
List
62
Create Workspace
Select Workspace
Delete Workspace
of shortcuts . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
79
79
80
80
This chapter provides an overview of the different areas in the user interface of CLC Protein
Workbench. As can be seen from figure 3.1 this includes a Navigation Area, View Area, Menu
Bar, Toolbar, Status Bar and Toolbox.
Figure 3.1: The user interface consists of the Menu Bar, Toolbar, Status Bar, Navigation Area,
Toolbox, and View Area.
3.1
Navigation Area
The Navigation Area is located in the left side of the screen, under the Toolbar (see figure 3.2).
It is used for organizing and navigating data. Its behavior is similar to the way files and folders
are usually displayed on your computer.
Figure 3.2: The Navigation Area.
CHAPTER 3. USER INTERFACE
3.1.1
63
Data structure
The data in the Navigation Area is organized into a number of Locations. When the CLC Protein
Workbench is started for the first time, there is one location called CLC_Data (unless your
computer administrator has configured the installation otherwise).
A location represents a folder on the computer: The data shown under a location in the Navigation
Area is stored on the computer in the folder which the location points to.
This is explained visually in figure 3.3.
Figure 3.3: In this example the location called 'CLC_Data' points to the folder at C:\Documents and
settings\clcuser\CLC_Data.
Adding locations
Per default, there is one location in the Navigation Area called CLC_Data. It points to the
following folder:
• On Windows: C:\Documents and settings\<username>\CLC_Data
• On Mac: /CLC_Data
• On Linux: /homefolder/CLC_Data
You can easily add more locations to the Navigation Area:
File | New | Location (
)
This will bring up a dialog where you can navigate to the folder you wish to use as your new
location (see figure 3.4).
When you click Open, the new location is added to the Navigation Area as shown in figure 3.5.
The name of the new location will be the name of the folder selected for the location. To see
where the folder is located on your computer, place your mouse cursor on the location icon ( )
for second. This will show the path to the location.
Sharing data is possible of you add a location on a network drive. The procedure is similar to
the one described above. When you add a location on a network drive or a removable drive, the
CHAPTER 3. USER INTERFACE
64
Figure 3.4: Navigating to a folder to use as a new location.
Figure 3.5: The new location has been added.
location will appear inactive when you are not connected. Once you connect to the drive again,
click Update All ( ) and it will become active (note that there will be a few seconds' delay from
you connect).
Opening data
The elements in the Navigation Area are opened by :
Double-click the element
or Click the element | Show ( ) in the Toolbar | Select the desired way to view the
element
This will open a view in the View Area, which is described in section 3.2.
Adding data
Data can be added to the Navigation Area in a number of ways. Files can be imported from
the file system (see chapter 7). Furthermore, an element can be added by dragging it into the
Navigation Area. This could be views that are open, elements on lists, e.g. search hits or
sequence lists, and files located on your computer. Finally, you can add data by adding a new
location (see section 3.1.1).
If a file or another element is dropped on a folder, it is placed at the bottom of the folder. If it is
dropped on another element, it will be placed just below that element.
If the element already exists in the Navigation Area, you will be asked whether you wish to create
CHAPTER 3. USER INTERFACE
65
a copy.
3.1.2
Create new folders
In order to organize your files, they can be placed in folders. Creating a new folder can be done
in two ways:
right-click an element in the Navigation Area | New | Folder (
or File | New | Folder (
)
)
If a folder is selected in the Navigation Area when adding a new folder, the new folder is added
at the bottom of this folder. If an element is selected, the new folder is added right above that
element.
You can move the folder manually by selecting it and dragging it to the desired destination.
3.1.3
Sorting folders
You can sort the elements in a folder alphabetically:
right-click the folder | Sort Folder
On Windows, subfolders will be placed at the top of the folder, and the rest of the elements will
be listed below in alphabetical order. On Mac, both subfolders and other elements are listed
together in alphabetical order.
3.1.4
Multiselecting elements
Multiselecting elements means that you select more than one element at the same time. This
can be done in the following ways:
• Holding down the <Ctrl> key ( on Mac) while clicking on multiple elements selects the
elements that have been clicked.
• Selecting one element, and selecting another element while holding down the <Shift> key
selects all the elements listed between the two locations (the two end locations included).
• Selecting one element, and moving the curser with the arrow-keys while holding down the
<Shift> key, enables you to increase the number of elements selected.
3.1.5
Moving and copying elements
Elements can be moved and copied in several ways:
• Using Copy (
• Using Ctrl + C (
• Using Copy (
), Cut (
) and Paste (
+ C on Mac), Ctrl + X (
), Cut (
) and Paste (
• Using drag and drop to move elements.
) from the Edit menu.
+ X on Mac) and Ctrl + V (
) in the Toolbar.
+ V on Mac).
CHAPTER 3. USER INTERFACE
66
• Using drag and drop while pressing Ctrl / Command to copy elements.
In the following, all of these possibilities for moving and copying elements are described in further
detail.
Copy, cut and paste functions
Copies of elements and folders can be made with the copy/paste function which can be applied
in a number of ways:
select the files to copy | right-click one of the selected files | Copy (
the location to insert files into | Paste ( )
or select the files to copy | Ctrl + C (
+ P ( + P on Mac)
) | right-click
+ C on Mac) | select where to insert files | Ctrl
or select the files to copy | Edit in the Menu Bar | Copy (
files | Edit in the Menu Bar | Paste ( )
) | select where to insert
If there is already an element of that name, the pasted element will be renamed by appending a
number at the end of the name.
Elements can also be moved instead of copied. This is done with the cut/paste function:
select the files to cut | right-click one of the selected files | Cut (
the location to insert files into | Paste ( )
or select the files to cut | Ctrl + X (
+ V ( + V on Mac)
) | right-click
+ X on Mac) | select where to insert files | Ctrl
When you have cut the element, it is "greyed out" until you activate the paste function. If you
change your mind, you can revert the cut command by copying another element.
Note that if you move data between locations, the original data is kept. This means that you are
essentially doing a copy instead of a move operation.
Move using drag and drop
Using drag and drop in the Navigation Area, as well as in general, is a four-step process:
click the element | click on the element again, and hold left mouse button | drag
the element to the desired location | let go of mouse button
This allows you to:
• Move elements between different folders in the Navigation Area
• Drag from the Navigation Area to the View Area: A new view is opened in an existing View
Area if the element is dragged from the Navigation Area and dropped next to the tab(s) in
that View Area.
• Drag from the View Area to the Navigation Area: The element, e.g. a sequence, alignment,
search report etc. is saved where it is dropped. If the element already exists, you are asked
whether you want to save a copy. You drag from the View Area by dragging the tab of the
desired element.
CHAPTER 3. USER INTERFACE
67
Use of drag and drop is supported throughout the program, also to open and re-arrange views
(see section 3.2.6).
Note that if you move data between locations, the original data is kept. This means that you are
essentially doing a copy instead of a move operation.
Copy using drag and drop
To copy instead of move using drag and drop, hold the Ctrl (
on Mac) key while dragging:
click the element | click on the element again, and hold left mouse button | drag
the element to the desired location | press Ctrl ( on Mac) while you let go of
mouse button release the Ctrl/ button
3.1.6
Change element names
This section describes two ways of changing the names of sequences in the Navigation Area. In
the first part, the sequences themselves are not changed - it's their representation that changes.
The second part describes how to change the name of the element.
Change how sequences are displayed
Sequence elements can be displayed in the Navigation Area with different types of information:
• Name (this is the default information to be shown).
• Accession (sequences downloaded from databases like GenBank have an accession
number).
• Latin name.
• Latin name (accession).
• Common name.
• Common name (accession).
Whether sequences can be displayed with this information depends on their origin. Sequences
that you have created yourself or imported might not include this information, and you will only be
able to see them represented by their name. However, sequences downloaded from databases
like GenBank will include this information. To change how sequences are displayed:
right-click any element or folder in the Navigation Area | Sequence Representation
| select format
This will only affect sequence elements, and the display of other types of elements, e.g.
alignments, trees and external files, will be not be changed. If a sequence does not have this
information, there will be no text next to the sequence icon.
CHAPTER 3. USER INTERFACE
68
Rename element
Renaming a folder or an element in the Navigation Area can be done in three different ways:
select the element | Edit in the Menu Bar | Rename
or select the element | F2
click the element once | wait one second | click the element again
When you can rename the element, you can see that the text is selected and you can move the
cursor back and forth in the text. When the editing of the name has finished; press Enter or
select another element in the Navigation Area. If you want to discard the changes instead, press
the Esc-key.
For renaming annotations instead of folders or elements, see section 10.3.3.
3.1.7
Delete elements
Deleting a folder or an element can be done in two ways:
right-click the element | Delete (
)
or select the element | press Delete key
This will cause the element to be moved to the Recycle Bin ( ) where it is kept until the recycle
bin is emptied. This means that you can recover deleted elements later on.
For deleting annotations instead of folders or elements, see section 10.3.4.
Restore Deleted Elements
The elements in the Recycle Bin ( ) can be restored by dragging the elements with the mouse
into the folder where they used to be.
If you have deleted large amounts of data taking up very much disk space, you can free this disk
space by emptying the Recycle Bin ( ):
Edit in the Menu Bar | Empty Recycle Bin (
)
Note! This cannot be undone, and you will therefore not be able to recover the data present in
the recycle bin when it was emptied.
3.1.8
Show folder elements in a table
A location or a folder might contain large amounts of elements. It is possible to view their
elements in the View Area:
select a folder or location | Show (
) in the Toolbar | Contents (
)
An example is shown in figure 3.6.
When the elements are shown in the view, they can be sorted by clicking the heading of each
of the columns. You can further refine the sorting by pressing Ctrl ( on Mac) while clicking the
heading of another column.
CHAPTER 3. USER INTERFACE
69
Figure 3.6: Viewing the elements in a folder.
Sorting the elements in a view does not affect the ordering of the elements in the Navigation
Area.
Note! The view only displays one "layer" at a time: the content of subfolders is not visible in this
view. Also note that only sequences have the full span of information like organism etc.
Batch edit folder elements
You can select a number of elements in the table, right-click and choose Edit to batch edit the
elements. In this way, you can change the e.g. the description or common name of several
elements in one go.
In figure 3.7 you can see an example where the common name of five sequence are renamed in
one go. In this example, a dialog with a text field will be shown, letting you enter a new common
name for these five sequences.
Note! This information is directly saved and you cannot
undo.
3.2
View Area
The View Area is the right-hand part of the screen, displaying your current work. The View Area
may consist of one or more Views, represented by tabs at the top of the View Area.
This is illustrated in figure 3.8.
The tab concept is central to working with CLC Protein Workbench, because several operations
can be performed by dragging the tab of a view, and extended right-click menus can be activated
from the tabs.
CHAPTER 3. USER INTERFACE
70
Figure 3.7: Changing the common name of five sequences.
Figure 3.8: A View Area can enclose several views, each view is indicated with a tab (see right view,
which shows protein P68225). Furthermore, several views can be shown at the same time (in this
example, four views are displayed).
This chapter deals with the handling of views inside a View Area. Furthermore, it deals with
rearranging the views.
Section 3.3 deals with the zooming and selecting functions.
3.2.1
Open view
Opening a view can be done in a number of ways:
double-click an element in the Navigation Area
CHAPTER 3. USER INTERFACE
71
or select an element in the Navigation Area | File | Show | Select the desired way to
view the element
or select an element in the Navigation Area | Ctrl + O (
+ B on Mac)
Opening a view while another view is already open, will show the new view in front of the other
view. The view that was already open can be brought to front by clicking its tab.
Note! If you right-click an open tab of any element, click Show, and then choose a different view
of the same element, this new view is automatically opened in a split-view, allowing you to see
both views.
See section 3.1.5 for instructions on how to open a view using drag and drop.
3.2.2
Show element in another view
Each element can be shown in different ways. A sequence, for example, can be shown as linear,
circular, text etc.
In the following example, you want to see a sequence in a circular view. If the sequence is
already open in a view, you can change the view to a circular view:
Click Show As Circular (
) at the lower left part of the view
The buttons used for switching views are shown in figure 3.9).
Figure 3.9: The buttons shown at the bottom of a view of a nucleotide sequence. You can click the
buttons to change the view to e.g. a circular view or a history view.
If the sequence is already open in a linear view (
linear view, you can split the views very easily:
), and you wish to see both a circular and a
Press Ctrl ( on Mac) while you | Click Show As Circular ( ) at the lower left part
of the view
This will open a split view with a linear view at the bottom and a circular view at the top (see
10.5).
You can also show a circular view of a sequence without opening the sequence first:
Select the sequence in the Navigation Area | Show (
3.2.3
) | As Circular (
)
Close views
When a view is closed, the View Area remains open as long as there is at least one open view.
A view is closed by:
right-click the tab of the View | Close
or select the view | Ctrl + W
or hold down the Ctrl-button | Click the tab of the view while the button is pressed
CHAPTER 3. USER INTERFACE
72
By right-clicking a tab, the following close options exist. See figure 3.10
Figure 3.10: By right-clicking a tab, several close options are available.
• Close. See above.
• Close Tab Area. Closes all tabs in the tab area.
• Close All Views. Closes all tabs, in all tab areas. Leaves an empty workspace.
• Close Other Tabs. Closes all other tabs, in all tab areas, except the one that is selected.
3.2.4
Save changes in a view
When changes are made in a view, the text on the tab appears bold and italic (on Mac it is
indicated by an * before the name of the tab). This indicates that the changes are not saved.
The Save function may be activated in two ways:
Click the tab of the view you want to save | Save (
) in the toolbar.
or Click the tab of the view you want to save | Ctrl + S (
+ S on Mac)
If you close a view containing an element that has been changed since you opened it, you are
asked if you want to save.
When saving a new view that has not been opened from the Navigation Area (e.g. when opening
a sequence from a list of search hits), a save dialog appears (figure 3.11).
In the dialog you select the folder in which you want to save the element.
After naming the element, press OK
3.2.5
Undo/Redo
If you make a change in a view, e.g. remove an annotation in a sequence or modify a tree, you
can undo the action. In general, Undo applies to all changes you can make when right-clicking in
a view. Undo is done by:
Click undo (
) in the Toolbar
CHAPTER 3. USER INTERFACE
73
Figure 3.11: Save dialog.
or Edit | Undo (
)
or Ctrl + Z
If you want to undo several actions, just repeat the steps above. To reverse the undo action:
Click the redo icon in the Toolbar
or Edit | Redo (
)
or Ctrl + Y
Note! Actions in the Navigation Area, e.g. renaming and moving elements, cannot be undone.
However, you can restore deleted elements (see section 3.1.7).
You can set the number of possible undo actions in the Preferences dialog (see section 5).
3.2.6
Arrange views in View Area
Views are arranged in the View Area by their tabs. The order of the views can be changed using
drag and drop. E.g. drag the tab of one view onto the tab of a another. The tab of the first view is
now placed at the right side of the other tab.
If a tab is dragged into a view, an area of the view is made gray (see fig. 3.12) illustrating that
the view will be placed in this part of the View Area.
The results of this action is illustrated in figure 3.13.
You can also split a View Area horizontally or vertically using the menus.
Splitting horisontally may be done this way:
right-click a tab of the view | View | Split Horizontally (
)
This action opens the chosen view below the existing view. (See figure 3.14). When the split is
made vertically, the new view opens to the right of the existing view.
Splitting the View Area can be undone by dragging e.g. the tab of the bottom view to the tab of
the top view. This is marked by a gray area on the top of the view.
CHAPTER 3. USER INTERFACE
74
Figure 3.12: When dragging a view, a gray area indicates where the view will be shown.
Figure 3.13: A horizontal split-screen. The two views split the View Area.
Maximize/Restore size of view
The Maximize/Restore View function allows you to see a view in maximized mode, meaning a
mode where no other views nor the Navigation Area is shown.
Maximizing a view can be done in the following ways:
select view | Ctrl + M
or select view | View | Maximize/restore View (
)
or select view | right-click the tab | View | Maximize/restore View (
or double-click the tab of view
The following restores the size of the view:
Ctrl + M
or View | Maximize/restore View (
or double-click title of view
)
)
CHAPTER 3. USER INTERFACE
75
Figure 3.14: A vertical split-screen.
Figure 3.15: A maximized view. The function hides the Navigation Area and the Toolbox.
3.2.7
Side Panel
The Side Panel allows you to change the way the contents of a view are displayed. The options
in the Side Panel depend on the kind of data in the view, and they are described in the relevant
sections about sequences, alignments, trees etc.
Side Panel are activated in this way:
select the view | Ctrl + U (
+ U on Mac)
or right-click the tab of the view | View | Show/Hide Side Panel (
)
Note! Changes made to the Side Panel will not be saved when you save the view. See how to
save the changes in the Side Panel in chapter 5 .
The Side Panel consists of a number of groups of preferences (depending on the kind of data
CHAPTER 3. USER INTERFACE
76
being viewed), which can be expanded and collapsed by clicking the header of the group. You
can also expand or collapse all the groups by clicking the icons ( )/ ( ) at the top.
3.3
Zoom and selection in View Area
The mode toolbar items in the right side of the Toolbar apply to the function of the mouse pointer.
When e.g. Zoom Out is selected, you zoom out each time you click in a view where zooming
is relevant (texts, tables and lists cannot be zoomed). The chosen mode is active until another
mode toolbar item is selected. (Fit Width and Zoom to 100% do not apply to the mouse pointer.)
Figure 3.16: The mode toolbar items.
3.3.1
Zoom In
There are four ways of Zooming In:
Click Zoom In (
zoom in on
) in the toolbar | click the location in the view that you want to.
or Click Zoom In ( ) in the toolbar | click-and-drag a box around a part of the view |
the view now zooms in on the part you selected
or Press '+' on your keyboard
The last option for zooming in is only available if you have a mouse with a scroll wheel:
or Press and hold Ctrl (
on Mac) | Move the scroll wheel on your mouse forward
When you choose the Zoom In mode, the mouse pointer changes to a magnifying glass to reflect
the mouse mode.
Note! You might have to click in the view before you can use the keyboard or the scroll wheel to
zoom.
If you press the Shift button on your keyboard while clicking in a View, the zoom function is
reversed. Hence, clicking on a sequence in this way while the Zoom In mode toolbar item is
selected, zooms out instead of zooming in.
3.3.2
Zoom Out
It is possible to zoom out, step by step, on a sequence:
Click Zoom Out ( ) in the toolbar | click in the view until you reach a satisfying.
zoomlevel
or Press '-' on your keyboard
The last option for zooming out is only available if you have a mouse with a scroll wheel:
or Press and hold Ctrl (
on Mac) | Move the scroll wheel on your mouse backwards
CHAPTER 3. USER INTERFACE
77
When you choose the Zoom Out mode, the mouse pointer changes to a magnifying glass to
reflect the mouse mode.
Note! You might have to click in the view before you can use the keyboard or the scroll wheel to
zoom.
If you want to get a quick overview of a sequence or a tree, use the Fit Width function instead of
the Zoom Out function.
If you press Shift while clicking in a View, the zoom function is reversed. Hence, clicking on a
sequence in this way while the Zoom Out mode toolbar item is selected, zooms in instead of
zooming out.
3.3.3
Fit Width
The Fit Width ( ) function adjusts the content of the View so that both ends of the sequence,
alignment, or tree is visible in the View in question. (This function does not change the mode of
the mouse pointer.)
3.3.4
Zoom to 100%
The Zoom to 100% ( ) function zooms the content of the View so that it is displayed with the
highest degree of detail. (This function does not change the mode of the mouse pointer.)
3.3.5
Move
The Move mode allows you to drag the content of a View. E.g. if you are studying a sequence,
you can click anywhere in the sequence and hold the mouse button. By moving the mouse you
move the sequence in the View.
3.3.6
Selection
The Selection mode ( ) is used for selecting in a View (selecting a part of a sequence, selecting
nodes in a tree etc.). It is also used for moving e.g. branches in a tree or sequences in an
alignment.
When you make a selection on a sequence or in an alignment, the location is shown in the bottom
right corner of the screen. E.g. '23 24' means that the selection is between two residues. '23'
means that the residue at position 23 is selected, and finally '23..25' means that 23, 24 and
25 are selected. By holding ctrl /
you can make multiple selections.
3.3.7
Changing compactness
There is a shortcut way of changing the compactness setting for read mappings:
or Press and hold Alt key | Scroll using your mouse wheel or touchpad
CHAPTER 3. USER INTERFACE
3.4
78
Toolbox and Status Bar
The Toolbox is placed in the left side of the user interface of CLC Protein Workbench below the
Navigation Area.
The Toolbox shows a Processes tab and a Toolbox tab.
3.4.1
Processes
By clicking the Processes tab, the Toolbox displays previous and running processes, e.g. an
NCBI search or a calculation of an alignment. The running processes can be stopped, paused,
and resumed by clicking the small icon ( ) next to the process (see figure 3.17).
Running and paused processes are not deleted.
Figure 3.17: A database search and an alignment calculation are running. Clicking the small icon
next to the process allow you to stop, pause and resume processes.
Besides the options to stop, pause and resume processes, there are some extra options for a
selected number of the tools running from the Toolbox:
• Show results. If you have chosen to save the results (see section 9.1), you will be able to
open the results directly from the process by clicking this option.
• Find results. If you have chosen to save the results (see section 9.1), you will be able to
high-light the results in the Navigation Area.
• Show Log Information. This will display a log file showing progress of the process. The
log file can also be shown by clicking Show Log in the "handle results" dialog where you
choose between saving and opening the results.
• Show Messages. Some analyses will give you a message when processing your data.
The messages are the black dialogs shown in the lower left corner of the Workbench that
disappear after a few seconds. You can reiterate the messages that have been shown by
clicking this option.
The terminated processes can be removed by:
View | Remove Terminated Processes (
)
If you close the program while there are running processes, a dialog will ask if you are sure that
you want to close the program. Closing the program will stop the process, and it cannot be
restarted when you open the program again.
CHAPTER 3. USER INTERFACE
3.4.2
79
Toolbox
The content of the Toolbox tab in the Toolbox corresponds to Toolbox in the Menu Bar.
The Toolbox can be hidden, so that the Navigation Area is enlarged and thereby displays more
elements:
View | Show/Hide Toolbox
The tools in the toolbox can be accessed by double-clicking or by dragging elements from the
Navigation Area to an item in the Toolbox.
3.4.3
Status Bar
As can be seen from figure 3.1, the Status Bar is located at the bottom of the window. In the
left side of the bar is an indication of whether the computer is making calculations or whether it
is idle. The right side of the Status Bar indicates the range of the selection of a sequence. (See
chapter 3.3.6 for more about the Selection mode button.)
3.5
Workspace
If you are working on a project and have arranged the views for this project, you can save this
arrangement using Workspaces. A Workspace remembers the way you have arranged the views,
and you can switch between different workspaces.
The Navigation Area always contains the same data across Workspaces. It is, however, possible
to open different folders in the different Workspaces. Consequently, the program allows you to
display different clusters of the data in separate Workspaces.
All Workspaces are automatically saved when closing down CLC Protein Workbench. The next
time you run the program, the Workspaces are reopened exactly as you left them.
Note! It is not possible to run more than one version of CLC Protein Workbench at a time. Use
two or more Workspaces instead.
3.5.1
Create Workspace
When working with large amounts of data, it might be a good idea to split the work into two
or more Workspaces. As default the CLC Protein Workbench opens one Workspace. Additional
Workspaces are created in the following way:
Workspace in the Menu Bar) | Create Workspace | enter name of Workspace | OK
When the new Workspace is created, the heading of the program frame displays the name of
the new Workspace. Initially, the selected elements in the Navigation Area is collapsed and the
View Area is empty and ready to work with. (See figure 3.18).
3.5.2
Select Workspace
When there is more than one Workspace in the CLC Protein Workbench, there are two ways to
switch between them:
CHAPTER 3. USER INTERFACE
80
Figure 3.18: An empty Workspace.
Workspace (
) in the Toolbar | Select the Workspace to activate
or Workspace in the Menu Bar | Select Workspace (
to activate | OK
) | choose which Workspace
The name of the selected Workspace is shown after "CLC Protein Workbench" at the top left
corner of the main window, in figure 3.18 it says: (default).
3.5.3
Delete Workspace
Deleting a Workspace can be done in the following way:
Workspace in the Menu Bar | Delete Workspace | choose which Workspace to
delete | OK
Note! Be careful to select the right Workspace when deleting. The delete action cannot be
undone. (However, no data is lost, because a workspace is only a representation of data.)
It is not possible to delete the default workspace.
3.6
List of shortcuts
The keyboard shortcuts in CLC Protein Workbench are listed below.
CHAPTER 3. USER INTERFACE
Action
Adjust selection
Change between tabs1
Close
Close all views
Copy
Cut
Delete
Exit
Export
Export graphics
Find Next Conflict
Find Previous Conflict
Help
Import
Maximize/restore size of View
Move gaps in alignment
Navigate sequence views
New Folder
New Sequence
View
Paste
Print
Redo
Rename
Save
Search local data
Search within a sequence
Search NCBI
Search UniProt
Select All
Selection Mode
Show/hide Side Panel
Sort folder
Split Horizontally
Split Vertically
Undo
User Preferences
Zoom In Mode
Zoom In (without clicking)
Zoom Out Mode
Zoom Out (without clicking)
Inverse zoom mode
81
Windows/Linux
Shift + arrow keys
Ctrl + tab
Ctrl + W
Ctrl + Shift + W
Ctrl + C
Ctrl + X
Delete
Alt + F4
Ctrl + E
Ctrl + G
Space or .
,
F1
Ctrl + I
Ctrl + M
Ctrl + arrow keys
arrow keys
Ctrl + Shift + N
Ctrl + N
Ctrl + O
Ctrl + V
Ctrl + P
Ctrl + Y
F2
Ctrl + S
Ctrl + F
Ctrl + Shift + F
Ctrl + B
Ctrl + Shift + U
Ctrl + A
Ctrl + 2
Ctrl + U
Ctrl + Shift + R
Ctrl + T
Ctrl + J
Ctrl + Z
Ctrl + K
Ctrl + + (plus)
+ (plus)
Ctrl + - (minus)
- (minus)
press and hold Shift
Mac OS X
Shift + arrow keys
Ctrl + Page Up/Down
+W
+ Shift + W
+C
+X
Delete or
+ Backspace
+Q
+E
+G
Space or .
,
F1
+I
+M
+ arrow keys
arrow keys
+ Shift + N
+N
+O
+V
+P
+Y
F2
+S
+F
+ Shift + F
+B
+ Shift + U
+A
+2
+U
+ Shift + R
+T
+J
+Z
+;
+3
+ (plus)
+4
- (minus)
press and hold Shift
Combinations of keys and mouse movements are listed below.
1
On Linux changing tabs is accomplished using Ctrl + Page Up/Page Down
CHAPTER 3. USER INTERFACE
82
Action
Windows/Linux Mac OS X Mouse movement
Maximize View
Double-click the tab of the View
Restore View
Double-click the View title
"ElReverse zoom function
Shift
Shift
Click in view
Select multiple elements Ctrl
Click elements
Select multiple elements Shift
Shift
Click elements
ements" in this context refers to elements and folders in the Navigation Area selections on
sequences, and rows in tables.
Chapter 4
Searching your data
Contents
4.1
What kind of information can be searched? . . . . . . . . . . . . . . . . . . .
83
4.2
Quick search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
84
4.2.1
Quick search results . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
84
4.2.2
Special search expressions . . . . . . . . . . . . . . . . . . . . . . . . .
85
4.2.3
Quick search history . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
86
4.3
Advanced search . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
86
4.4
Search index . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
88
There are two ways of doing text-based searches of your data, as described in this chapter:
• Quick-search directly from the search field in the Navigation Area.
• Advanced search which makes it easy to make more specific searches.
In most cases, quick-search will find what you need, but if you need to be more specific in your
search criteria, the advanced search is preferable.
4.1
What kind of information can be searched?
Below is a list of the different kinds of information that you can search for (applies to both
quick-search and the advanced search).
• Name. The name of a sequence, an alignment or any other kind of element. The name is
what is displayed in the Navigation Area per default.
• Length. The length of the sequence.
• Organism. Sequences which contain information about organism can be searched. In this
way, you could search for e.g. Homo sapiens sequences.
• Database fields. If your data is stored in a CLC Bioinformatics Database, you will be able
to search for custom defined information. Read more in the database user manual.
83
CHAPTER 4. SEARCHING YOUR DATA
84
Only the first item in the list, Name, is available for all kinds of data. The rest is only relevant for
sequences.
If you wish to perform a search for sequence similarity, use Local BLAST (see section 12.1.3)
instead.
4.2
Quick search
At the bottom of the Navigation Area there is a text field as shown in figure 4.1).
Figure 4.1: Search simply by typing in the text field and press Enter.
To search, simply enter a text to search for and press Enter.
4.2.1
Quick search results
To show the results, the search pane is expanded as shown in figure 4.2).
Figure 4.2: Search results.
If there are many hits, only the 50 first hits are immediately shown. At the bottom of the pane
you can click Next ( ) to see the next 50 hits (see figure 4.3).
If a search gives no hits, you will be asked if you wish to search for matches that start with your
search term. If you accept this, an asterisk (*) will be appended to the search term.
Pressing the Alt key while you click a search result will high-light the search hit in its folder in the
Navigation Area.
CHAPTER 4. SEARCHING YOUR DATA
85
Figure 4.3: Page two of the search results.
In the preferences (see 5), you can specify the number of hits to be shown.
4.2.2
Special search expressions
When you write a search term in the search field, you can get help to write a more advanced
search expression by pressing Shift+F1. This will reveal a list of guides as shown in figure 4.4.
Figure 4.4: Guides to help create advanced search expressions.
You can select any of the guides (using mouse or keyboard arrows), and start typing. If you e.g.
wish to search for sequences named BRCA1, select "Name search (name:)", and type "BRCA1".
Your search expression will now look like this: "name:BRCA1".
The guides available are these:
• Wildcard search (*). Appending an asterisk * to the search term will find matches starting
with the term. E.g. searching for "brca*" will find both brca1 and brca2.
• Search related words ( ). If you don't know the exact spelling of a word, you can append a
question mark to the search term. E.g. "brac1*" will find sequences with a brca1 gene.
CHAPTER 4. SEARCHING YOUR DATA
86
• Include both terms (AND). If you write two search terms, you can define if your results
have to match both search terms by combining them with AND. E.g. search for "brca1 AND
human" will find sequences where both terms are present.
• Include either term (OR). If you write two search terms, you can define that your results
have to match either of the search terms by combining them with OR. E.g. search for "brca1
OR brca2" will find sequences where either of the terms is present.
• Name search (name:). Search only the name of element.
• Organism search (organism:). For sequences, you can specify the organism to search
for. This will look in the "Latin name" field which is seen in the Sequence Info view (see
section 10.4).
• Length search (length:[START TO END]). Search for sequences of a specific length. E.g.
search for sequences between 1000 and 2000 residues: "length:1000 TO 2000".
If you do not use this special syntax, you will automatically search for both name, description,
organism, etc., and search terms will be combined as if you had put OR between them.
4.2.3
Quick search history
You can access the 10 most recent searches by clicking the icon (
(see figure 4.5).
) next to the search field
Figure 4.5: Recent searches.
Clicking one of the recent searches will conduct the search again.
4.3
Advanced search
As a supplement to the Quick search described in the previous section you can use the more
advanced search:
Search | Local Search (
or Ctrl + F (
)
+ F on Mac)
This will open the search view as shown in figure 4.6
The first thing you can choose is which location should be searched. All the active locations are
shown in this list. You can also choose to search all locations. Read more about locations in
section 3.1.1.
Furthermore, you can specify what kind of elements should be searched:
CHAPTER 4. SEARCHING YOUR DATA
87
Figure 4.6: Advanced search.
• All sequences
• Nucleotide sequences
• Protein sequences
• All data
When searching for sequences, you will also get alignments, sequence lists etc as result, if they
contain a sequence which match the search criteria.
Below are the search criteria. First, select a relevant search filter in the Add filter: list. For
sequences you can search for
• Name
• Length
• Organism
See section 4.2.2 for more information on individual search terms.
For all other data, you can only search for name.
If you use Any field, it will search all of the above plus the following:
• Description
• Keywords
• Common name
• Taxonomy name
CHAPTER 4. SEARCHING YOUR DATA
To see this information for a sequence, switch to the Element Info (
88
) view (see section 10.4).
For each search line, you can choose if you want the exact term by selecting "is equal to" or if
you only enter the start of the term you wish to find (select "begins with").
An example is shown in figure 4.7.
Figure 4.7: Searching for human sequences shorter than 10,000 nucleotides.
This example will find human nucleotide sequences (organism is Homo sapiens), and it will only
find sequences shorter than 10,000 nucleotides.
Note that a search can be saved ( ) for later use. You do not save the search results - only the
search parameters. This means that you can easily conduct the same search later on when your
data has changed.
4.4
Search index
This section has a technical focus and is not relevant if your search works fine.
However, if you experience problems with your search results: if you do not get the hits you
expect, it might be because of an index error.
The CLC Protein Workbench automatically maintains an index of all data in all locations in the
Navigation Area. If this index becomes out of sync with the data, you will experience problems
with strange results. In this case, you can rebuild the index:
Right-click the relevant location | Location | Rebuild Index
This will take a while depending on the size of your data. At any time, the process can be stopped
in the process area, see section 3.4.1.
Chapter 5
User preferences and settings
Contents
5.1
5.2
General preferences . . . . . . . . . . . . . . . . .
Default view preferences . . . . . . . . . . . . . .
5.2.1
Number formatting in tables . . . . . . . . .
5.2.2
Import and export Side Panel settings . . . .
5.3
Advanced preferences . . . . . . . . . . . . . . .
5.3.1
Default data location . . . . . . . . . . . . .
5.3.2
NCBI BLAST . . . . . . . . . . . . . . . . . .
5.4
Export/import of preferences . . . . . . . . . . .
5.4.1
The different options for export and importing
5.5
View settings for the Side Panel . . . . . . . . . .
5.5.1
Floating Side Panel . . . . . . . . . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
89
90
91
92
93
93
94
94
94
95
97
The first three sections in this chapter deal with the general preferences that can be set for CLC
Protein Workbench using the Preferences dialog. The next section explains how the settings in
the Side Panel can be saved and applied to other views. Finally, you can learn how to import and
export the preferences.
The Preferences dialog offers opportunities for changing the default settings for different features
of the program.
The Preferences dialog is opened in one of the following ways and can be seen in figure 5.1:
Edit | Preferences (
or Ctrl + K (
5.1
)
+ ; on Mac)
General preferences
The General preferences include:
• Undo Limit. As default the undo limit is set to 500. By writing a higher number in this field,
more actions can be undone. Undo applies to all changes made on sequences, alignments
or trees. See section 3.2.5 for more on this topic.
89
CHAPTER 5. USER PREFERENCES AND SETTINGS
90
Figure 5.1: Preferences include General preferences, View preferences, Colors preferences, and
Advanced settings.
• Audit Support. If this option is checked, all manual editing of sequences will be marked
with an annotation on the sequence (see figure 5.2). Placing the mouse on the annotation
will reveal additional details about the change made to the sequence (see figure 5.3). Note
that no matter whether Audit Support is checked or not, all changes are also recorded in
the History ( ) (see section 8).
• Number of hits. The number of hits shown in CLC Protein Workbench, when e.g. searching
NCBI. (The sequences shown in the program are not downloaded, until they are opened or
dragged/saved into the Navigation Area.
• Locale Setting. Specify which country you are located in. This determines how punctation
is used in numbers all over the program.
• Show Dialogs. A lot of information dialogs have a checkbox: "Never show this dialog
again". When you see a dialog and check this box in the dialog, the dialog will not be shown
again. If you regret and wish to have the dialog displayed again, click the button in the
General Preferences: Show Dialogs. Then all the dialogs will be shown again.
Figure 5.2: Annotations added when the sequence is edited.
Figure 5.3: Details of the editing.
5.2
Default view preferences
There are five groups of default View settings:
CHAPTER 5. USER PREFERENCES AND SETTINGS
91
1. Toolbar
2. Side Panel Location
3. New View
4. View Format
5. User Defined View Settings.
In general, these are default settings for the user interface.
The Toolbar preferences let you choose the size of the toolbar icons, and you can choose whether
to display names below the icons.
The Side Panel Location setting lets you choose between Dock in views and Float in window.
When docked in view, view preferences will be located in the right side of the view of e.g. an
alignment. When floating in window, the side panel can be placed everywhere in your screen,
also outside the workspace, e.g. on a different screen. See section 5.5 for more about floating
side panels.
The New view setting allows you to choose whether the View preferences are to be shown
automatically when opening a new view. If this option is not chosen, you can press (Ctrl + U (
+ U on Mac)) to see the preferences panels of an open view.
The View Format allows you to change the way the elements appear in the Navigation Area. The
following text can be used to describe the element:
• Name (this is the default information to be shown).
• Accession (sequences downloaded from databases like GenBank have an accession
number).
• Latin name.
• Latin name (accession).
• Common name.
• Common name (accession).
The User Defined View Settings gives you an overview of the different Side Panel settings that
are saved for each view. See section 5.5 for more about how to create and save style sheets.
If there are other settings beside CLC Standard Settings, you can use this overview to choose
which of the settings should be used per default when you open a view (see an example in
figure 5.4).
In this example, the CLC Standard Settings is chosen as default.
5.2.1
Number formatting in tables
In the preferences, you can specify how the numbers should be formatted in tables (see
figure 5.5).
CHAPTER 5. USER PREFERENCES AND SETTINGS
92
Figure 5.4: Selecting the default view setting.
Figure 5.5: Number formatting of tables.
The examples below the text field are updated when you change the value so that you can see
the effect. After you have changed the preference, you have to re-open your tables to see the
effect.
5.2.2
Import and export Side Panel settings
If you have created a special set of settings in the Side Panel that you wish to share with other
CLC users, you can export the settings in a file. The other user can then import the settings.
To export the Side Panel settings, first select the views that you wish to export settings for. Use
Ctrl+click ( + click on Mac) or Shift+click to select multiple views. Next click the Export...button.
Note that there is also another export button at the very bottom of the dialog, but this will export
the other settings of the Preferences dialog (see section 5.4).
A dialog will be shown (see figure 5.6) that allows you to select which of the settings you wish to
export.
When multiple views are selected for export, all the view settings for the views will be shown
in the dialog. Click Export and you will now be able to define a save folder and name for the
exported file. The settings are saved in a file with a .vsf extension (View Settings File).
To import a Side Panel settings file, make sure you are at the bottom of the View panel of the
Preferences dialog, and click the Import... button. Note that there is also another import button
at the very bottom of the dialog, but this will import the other settings of the Preferences dialog
(see section 5.4).
The dialog asks if you wish to overwrite existing Side Panel settings, or if you wish to merge the
CHAPTER 5. USER PREFERENCES AND SETTINGS
93
Figure 5.6: Exporting all settings for circular views.
imported settings into the existing ones (see figure 5.7).
Figure 5.7: When you import settings, you are asked if you wish to overwrite existing settings or if
you wish to merge the new settings into the old ones.
Note! If you choose to overwrite the existing settings, you will loose all the Side Panel settings
that you have previously saved.
To avoid confusion of the different import and export options, here is an overview:
• Import and export of bioinformatics data such as sequences, alignments etc. (described
in section 7.1.1).
• Graphics export of the views which creates image files in various formats (described in
section 7.3).
• Import and export of Side Panel Settings as described above.
• Import and export of all the Preferences except the Side Panel settings. This is described
in the previous section.
5.3
Advanced preferences
The Advanced settings include the possibility to set up a proxy server. This is described in
section 1.8.
5.3.1
Default data location
If you have more than one location in the Navigation Area, you can choose which location should
be the default data location. The default location is used when you e.g. import a file without
selecting a folder or element in the Navigation Area first. Then the imported element will be
placed in the default location.
CHAPTER 5. USER PREFERENCES AND SETTINGS
94
Note! The default location cannot be removed. You have to select another location as default
first.
5.3.2
NCBI BLAST
URL to use for BLAST
It is possible to specify an alternate server URL to use for BLAST searches. The standard URL
for the BLAST server at NCBI is: http://blast.ncbi.nlm.nih.gov/Blast.cgi.
Note! Be careful to specify a valid URL, otherwise BLAST will not work.
5.4
Export/import of preferences
The user preferences of the CLC Protein Workbench can be exported to other users of the
program, allowing other users to display data with the same preferences as yours. You can also
use the export/import preferences function to backup your preferences.
To export preferences, open the Preferences dialog (Ctrl + K (
+ ; on Mac)) and do the following:
Export | Select the relevant preferences | Export | Choose location for the exported
file | Enter name of file | Save
Note! The format of exported preferences is .cpf. This notation must be submitted to the name
of the exported file in order for the exported file to work.
Before exporting, you are asked about which of the different settings you want to include in the
exported file. One of the items in the list is "User Defined View Settings". If you export this, only
the information about which of the settings is the default setting for each view is exported. If you
wish to export the Side Panel Settings themselves, see section 5.2.2.
The process of importing preferences is similar to exporting:
Press Ctrl + K ( + ; on Mac) to open Preferences | Import | Browse to and select
the .cpf file | Import and apply preferences
5.4.1
The different options for export and importing
To avoid confusion of the different import and export options, here is an overview:
• Import and export of bioinformatics data such as sequences, alignments etc. (described
in section 7.1.1).
• Graphics export of the views which creates image files in various formats (described in
section 7.3).
• Import and export of Side Panel Settings as described in the next section.
• Import and export of all the Preferences except the Side Panel settings. This is described
above.
CHAPTER 5. USER PREFERENCES AND SETTINGS
5.5
95
View settings for the Side Panel
The Side Panel is shown to the right of all views that are opened in CLC Protein Workbench. By
using the settings in the Side Panel you can specify how the layout and contents of the view.
Figure 5.8 is an example of the Side Panel of a sequence view.
Figure 5.8: The Side Panel of a sequence contains several groups: Sequence layout, Annotation
types, Annotation layout, etc. Several of these groups are present in more views. E.g. Sequence
layout is also in the Side Panel of alignment views.
By clicking the black triangles or the corresponding headings, the groups can be expanded or
collapsed. An example is shown in figure 5.9 where the Sequence layout is expanded.
Figure 5.9: The Sequence layout is expanded.
CHAPTER 5. USER PREFERENCES AND SETTINGS
96
The content of the groups is described in the sections where the functionality is explained. E.g.
Sequence Layout for sequences is described in chapter 10.1.1.
When you have adjusted a view of e.g. a sequence, your settings in the Side Panel can be saved.
When you open other sequences, which you want to display in a similar way, the saved settings
can be applied. The options for saving and applying are available in the top of the Side Panel
(see figure 5.10).
Figure 5.10: At the top of the Side Panel you can: Expand all groups, Collapse all preferences,
Dock/Undock preferences, Help, and Save/Restore preferences.
To save and apply the saved settings, click (
the following options are available:
) seen in figure 5.10. This opens a menu, where
• Save Settings. This brings up a dialog as shown in figure 5.11 where you can enter a name
for your settings. Furthermore, by clicking the checkbox Always apply these settings, you
can choose to use these settings every time you open a new view of this type. If you wish
to change which settings should be used per default, open the Preferences dialog (see
section 5.2).
• Delete Settings. Opens a dialog to select which of the saved settings to delete.
• Apply Saved Settings. This is a submenu containing the settings that you have previously
saved. By clicking one of the settings, they will be applied to the current view. You will
also see a number of pre-defined view settings in this submenu. They are meant to be
examples of how to use the Side Panel and provide quick ways of adjusting the view to
common usages. At the bottom of the list of settings you will see CLC Standard Settings
which represent the way the program was set up, when you first launched it.
Figure 5.11: The save settings dialog.
The settings are specific to the type of view. Hence, when you save settings of a circular view,
they will not be available if you open the sequence in a linear view.
If you wish to export the settings that you have saved, this can be done in the Preferences dialog
under the View tab (see section 5.2.2).
The remaining icons of figure 5.10 are used to; Expand all groups, Collapse all groups, and
Dock/Undock Side Panel. Dock/Undock Side Panel is to make the Side Panel "floating" (see
below).
CHAPTER 5. USER PREFERENCES AND SETTINGS
97
Figure 5.12: Applying saved settings.
5.5.1
Floating Side Panel
The Side Panel of the views can be placed in the right side of a view, or it can be floating (see
figure 5.13).
Figure 5.13: The floating Side Panel can be moved out of the way, e.g. to allow for a wider view of
a table.
By clicking the Dock icon ( ) the floating Side Panel reappear in the right side of the view. The
size of the floating Side Panel can be adjusted by dragging the hatched area in the bottom right.
Chapter 6
Printing
Contents
6.1
Selecting which part of the view to print . . . . . . . . . . . . . . . . . . . .
6.2
Page setup . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 100
6.2.1
6.3
99
Header and footer . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101
Print preview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 101
CLC Protein Workbench offers different choices of printing the result of your work.
This chapter deals with printing directly from CLC Protein Workbench. Another option for using the
graphical output of your work, is to export graphics (see chapter 7.3) in a graphic format, and
then import it into a document or a presentation.
All the kinds of data that you can view in the View Area can be printed. The CLC Protein
Workbench uses a WYSIWYG principle: What You See Is What You Get. This means that you
should use the options in the Side Panel to change how your data, e.g. a sequence, looks on the
screen. When you print it, it will look exactly the same way on print as on the screen.
For some of the views, the layout will be slightly changed in order to be printer-friendly.
It is not possible to print elements directly from the Navigation Area. They must first be opened
in a view in order to be printed. To print the contents of a view:
select relevant view | Print (
) in the toolbar
This will show a print dialog (see figure 6.1).
In this dialog, you can:
• Select which part of the view you want to print.
• Adjust Page Setup.
• See a print Preview window.
These three options are described in the three following sections.
98
CHAPTER 6. PRINTING
99
Figure 6.1: The Print dialog.
6.1
Selecting which part of the view to print
In the print dialog you can choose to:
• Print visible area, or
• Print whole view
These options are available for all views that can be zoomed in and out. In figure 6.2 is a view of
a circular sequence which is zoomed in so that you can only see a part of it.
Figure 6.2: A circular sequence as it looks on the screen.
When selecting Print visible area, your print will reflect the part of the sequence that is visible in
the view. The result from printing the view from figure 6.2 and choosing Print visible area can be
seen in figure 6.3.
Figure 6.3: A print of the sequence selecting Print visible area.
On the other hand, if you select Print whole view, you will get a result that looks like figure 6.4.
This means that you also print the part of the sequence which is not visible when you have
zoomed in.
CHAPTER 6. PRINTING
100
Figure 6.4: A print of the sequence selecting Print whole view. The whole sequence is shown, even
though the view is zoomed in on a part of the sequence.
6.2
Page setup
No matter whether you have chosen to print the visible area or the whole view, you can adjust
page setup of the print. An example of this can be seen in figure 6.5
Figure 6.5: Page Setup.
In this dialog you can adjust both the setup of the pages and specify a header and a footer by
clicking the tab at the top of the dialog.
You can modify the layout of the page using the following options:
• Orientation.
Portrait. Will print with the paper oriented vertically.
Landscape. Will print with the paper oriented horizontally.
• Paper size. Adjust the size to match the paper in your printer.
• Fit to pages. Can be used to control how the graphics should be split across pages (see
figure 6.6 for an example).
Horizontal pages. If you set the value to e.g. 2, the printed content will be broken
up horizontally and split across 2 pages. This is useful for sequences that are not
wrapped
Vertical pages. If you set the value to e.g. 2, the printed content will be broken up
vertically and split across 2 pages.
Note! It is a good idea to consider adjusting view settings (e.g. Wrap for sequences), in the
Side Panel before printing. As explained in the beginning of this chapter, the printed material will
look like the view on the screen, and therefore these settings should also be considered when
adjusting Page Setup.
CHAPTER 6. PRINTING
101
Figure 6.6: An example where Fit to pages horizontally is set to 2, and Fit to pages vertically is set
to 3.
6.2.1
Header and footer
Click the Header/Footer tab to edit the header and footer text. By clicking in the text field
for either Custom header text or Custom footer text you can access the auto formats for
header/footer text in Insert a caret position. Click either Date, View name, or User name to
include the auto format in the header/footer text.
Click OK when you have adjusted the Page Setup. The settings are saved so that you do not
have to adjust them again next time you print. You can also change the Page Setup from the File
menu.
6.3
Print preview
The preview is shown in figure 6.7.
Figure 6.7: Print preview.
The Print preview window lets you see the layout of the pages that are printed. Use the arrows
in the toolbar to navigate between the pages. Click Print ( ) to show the print dialog, which lets
you choose e.g. which pages to print.
The Print preview window is for preview only - the layout of the pages must be adjusted in the
Page setup.
Chapter 7
Import/export of data and graphics
Contents
7.1
7.2
7.3
Bioinformatic data formats . . . . . . . . . . . . . . . . . . . . . . . . . . . . 102
7.1.1
Import of bioinformatic data . . . . . . . . . . . . . . . . . . . . . . . . . 103
7.1.2
Import Vector NTI data
7.1.3
Export of bioinformatics data . . . . . . . . . . . . . . . . . . . . . . . . 107
. . . . . . . . . . . . . . . . . . . . . . . . . . . 104
External files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
Export graphics to files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 109
7.3.1
Which part of the view to export
. . . . . . . . . . . . . . . . . . . . . . 110
7.3.2
Save location and file formats . . . . . . . . . . . . . . . . . . . . . . . 110
7.3.3
Graphics export parameters . . . . . . . . . . . . . . . . . . . . . . . . . 112
7.3.4
Exporting protein reports . . . . . . . . . . . . . . . . . . . . . . . . . . 113
7.4
Export graph data points to a file . . . . . . . . . . . . . . . . . . . . . . . . 113
7.5
Copy/paste view output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 115
CLC Protein Workbench handles a large number of different data formats. All data stored in the
Workbench are available in the Navigation Area. The data of the Navigation Area can be divided
into two groups. The data is either one of the different bioinformatic data formats, or it can be an
'external file'. Bioinformatic data formats are those formats which the program can work with,
e.g. sequences, alignments and phylogenetic trees. External files are files or links which are
stored in CLC Protein Workbench, but are opened by other applications, e.g. pdf-files, Microsoft
Word files, Open Office spreadsheet files, or links to programs and web-pages etc.
This chapter first deals with importing and exporting data in bioinformatic data formats and as
external files. Next comes an explanation of how to export graph data points to a file, and how
export graphics.
7.1
Bioinformatic data formats
The different bioinformatic data formats are imported in the same way, therefore, the following
description of data import is an example which illustrates the general steps to be followed,
regardless of which format you are handling.
102
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
7.1.1
103
Import of bioinformatic data
CLC Protein Workbench has support for a wide range of bioinformatic data such as sequences,
alignments etc. See a full list of the data formats in section F.1.
The CLC Protein Workbench offers a lot of possibilities to handle bioinformatic data. Read the
next sections to get information on how to import different file formats or to import data from a
Vector NTI database.
Import using the import dialog
To start the import using the import dialog:
click Import (
) in the Toolbar
This will show a dialog similar to figure 7.1 (depending on which platform you use). You can
change which kind of file types that should be shown by selecting a file format in the Files of
type box.
Figure 7.1: The import dialog.
Next, select one or more files or folders to import and click Select.
This allows you to select a place for saving the result files.
If you import one or more folders, the contents of the folder is automatically imported and placed
in that folder in the Navigation Area. If the folder contains subfolders, the whole folder structure
is imported.
In the import dialog (figure 7.1), there are three import options:
Automatic import This will import the file and CLC Protein Workbench will try to determine the
format of the file. The format is determined based on the file extension (e.g. SwissProt
files have .swp at the end of the file name) in combination with a detection of elements in
the file that are specific to the individual file formats. If the file type is not recognized, it
will be imported as an external file. In most cases, automatic import will yield a successful
result, but if the import goes wrong, the next option can be helpful:
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
104
Force import as type This option should be used if CLC Protein Workbench cannot successfully
determine the file format. By forcing the import as a specific type, the automatic
determination of the file format is bypassed, and the file is imported as the type specified.
Force import as external file This option should be used if a file is imported as a bioinformatics
file when it should just have been external file. It could be an ordinary text file which is
imported as a sequence.
Import using drag and drop
It is also possible to drag a file from e.g. the desktop into the Navigation Area of CLC Protein
Workbench. This is equivalent to importing the file using the Automatic import option described
above. If the file type is not recognized, it will be imported as an external file.
Import using copy/paste of text
If you have e.g. a text file or a browser displaying a sequence in one of the formats that can
be imported by CLC Protein Workbench, there is a very easy way to get this sequence into the
Navigation Area:
Copy the text from the text file or browser | Select a folder in the Navigation Area
| Paste ( )
This will create a new sequence based on the text copied. This operation is equivalent to saving
the text in a text file and importing it into the CLC Protein Workbench.
If the sequence is not formatted, i.e. if you just have a text like this: "ATGACGAATAGGAGTTCTAGCTA" you can also paste this into the Navigation Area.
Note! Make sure you copy all the relevant text - otherwise CLC Protein Workbench might not be
able to interpret the text.
7.1.2
Import Vector NTI data
There are several ways of importing your Vector NTI data into the CLC Workbench. The best way
to go depends on how your data is currently stored in Vector NTI:
• Your data is stored in the Vector NTI Local Database which can be accessed through Vector
NTI Explorer. This is described in the first section below.
• Your data is stored as single files on your computer (just like Word documents etc.). This
is described in the second section below.
Import from the Vector NTI Local Database
If your Vector NTI data are stored in a Vector NTI Local Database (as the one shown in figure 7.2),
you can import all the data in one step, or you can import selected parts of it.
Importing the entire database in one step
From the Workbench, there is a direct import of the whole database (see figure 7.3):
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
105
Figure 7.2: Data stored in the Vector NTI Local Database accessed through Vector NTI Explorer.
File | Import Vector NTI Database
Figure 7.3: Import the whole Vector NTI Database.
This will bring up a dialog letting you choose to import from the default location of the database,
or you can specify another location. If the database is installed in the default folder, like e.g.
C:\VNTI Database, press Yes. If not, click No and specify the database folder manually.
When the import has finished, the data will be listed in the Navigation Area of the Workbench as
shown in figure 7.4.
If something goes wrong during the import process, please report the problem to [email protected]. To circumvent the problem, see the following section on how to import
parts of the database. It will take a few more steps, but you will most likely be able to import
this way.
Importing parts of the database
Instead of importing the whole database automatically, you can export parts of the database
from Vector NTI Explorer and subsequently import into the Workbench. First, export a selection
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
106
Figure 7.4: The Vector NTI Data folder containing all imported sequences of the Vector NTI
Database.
of files as an archive as shown in figure 7.5.
Figure 7.5: Select the relevant files and export them as an archive through the File menu.
This will produce a file with a ma4-, pa4- or oa4-extension. Back in the CLC Workbench, click
Import ( ) and select the file.
Importing single files
In Vector NTI, you can save a sequence in a file instead of in the database (see figure 7.6).
This will give you file with a .gb extension. This file can be easily imported into the CLC Workbench:
Import (
) | select the file | Select
You don't have to import one file at a time. You can simply select a bunch of files or an entire
folder, and the CLC Workbench will take care of the rest. Even if the files are in different formats.
You can also simply drag and drop the files into the Navigation Area of the CLC Workbench.
The Vector NTI import is a plug-in which is pre-installed in the Workbench. It can be uninstalled
and updated using the plug-in manager (see section 1.7).
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
107
Figure 7.6: Saving a sequence as a file in Vector NTI.
7.1.3
Export of bioinformatics data
CLC Protein Workbench can export bioinformatic data in most of the formats that can be imported.
There are a few exceptions. See section 7.1.1.
To export a file:
select the element to export | Export (
'File of type' | enter name of file | Save
) | choose where to export to | select
When exporting to CSV and tab delimited files, decimal numbers are formatted according to the
Locale setting of the Workbench (see section 5.1). If you open the CSV or tab delimited file
with spreadsheet software like Excel, you should make sure that both the Workbench and the
spreadsheet software are using the same Locale.
Note! The Export dialog decides which types of files you are allowed to export into, depending
on what type of data you want to export. E.g. protein sequences can be exported into GenBank,
Fasta, Swiss-Prot and CLC-formats.
Export of folders and multiple elements
The .zip file type can be used to export all kinds of files and is therefore especially useful in
these situations:
• Export of one or more folders including all underlying elements and folders.
• If you want to export two or more elements into one file.
Export of folders is similar to export of single files. Exporting multiple files (of different formats)
is done in .zip-format. This is how you export a folder:
select the folder to export | Export (
Save
) | choose where to export to | enter name |
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
108
You can export multiple files of the same type into formats other than ZIP (.zip). E.g. two DNA
sequences can be exported in GenBank format:
select the two sequences by <Ctrl>-click ( -click on Mac) or <Shift>-click | Export
( ) | choose where to export to | choose GenBank (.gbk) format | enter name the
new file | Save
Export of dependent elements
When exporting e.g. an alignment, CLC Protein Workbench can export the alignment including
all the sequences that were used to create it. This way, when sending your alignment (with the
dependent sequences), your colleagues can reproduce your findings with adjusted parameters, if
desired. To export with dependent files:
select the element in Navigation Area | File in Menu Bar | Export with Dependent
Elements | enter name of of the new file | choose where to export to | Save
The result is a folder containing the exported file with dependent elements, stored automatically
in a folder on the desired location of your desk.
Export history
To export an element's history:
select the element in Navigation Area Export (
choose where to export to | Save
) | select History PDF(.pdf) |
The entire history of the element is then exported in pdf format.
The CLC format
CLC Protein Workbench keeps all bioinformatic data in the CLC format. Compared to other formats,
the CLC format contains more information about the object, like its history and comments. The
CLC format is also able to hold several elements of different types (e.g. an alignment, a graph and
a phylogenetic tree). This means that if you are exporting your data to another CLC Workbench,
you can use the CLC format to export several elements in one file, and you will preserve all the
information.
Note! CLC files can be exported from and imported into all the different CLC Workbenches.
Backup
If you wish to secure your data from computer breakdowns, it is advisable to perform regular
backups of your data. Backing up data in the CLC Protein Workbench is done in two ways:
• Making a backup of each of the folders represented by the locations in the Navigation
Area.
• Selecting all locations in the Navigation Area and export ( ) in .zip format. The resulting
file will contain all the data stored in the Navigation Area and can be imported into CLC
Protein Workbench if you wish to restore from the back-up at some point.
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
109
No matter which method is used for backup, you may have to re-define the locations in the
Navigation Area if you restore your data from a computer breakdown.
7.2
External files
In order to help you organize your research projects, CLC Protein Workbench lets you import all
kinds of files. E.g. if you have Word, Excel or pdf-files related to your project, you can import them
into the Navigation Area of CLC Protein Workbench. Importing an external file creates a copy of
the file which is stored at the location you have chosen for import. The file can now be opened
by double-clicking the file in the Navigation Area. The file is opened using the default application
for this file type (e.g. Microsoft Word for .doc-files and Adobe Reader for .pdf).
External files are imported and exported in the same way as bioinformatics files (see section 7.1.1). Bioinformatics files not recognized by CLC Protein Workbench are also treated as
external files.
7.3
Export graphics to files
CLC Protein Workbench supports export of graphics into a number of formats. This way, the
visible output of your work can easily be saved and used in presentations, reports etc. The
Export Graphics function ( ) is found in the Toolbar.
CLC Protein Workbench uses a WYSIWYG principle for graphics export: What You See Is What
You Get. This means that you should use the options in the Side Panel to change how your data,
e.g. a sequence, looks in the program. When you export it, the graphics file will look exactly the
same way.
It is not possible to export graphics of elements directly from the Navigation Area. They must
first be opened in a view in order to be exported. To export graphics of the contents of a view:
select tab of View | Graphics (
) on Toolbar
This will display the dialog shown in figure 7.7.
Figure 7.7: Selecting to export whole view or to export only the visible area.
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
7.3.1
110
Which part of the view to export
In this dialog you can choose to:
• Export visible area, or
• Export whole view
These options are available for all views that can be zoomed in and out. In figure 7.8 is a view of
a circular sequence which is zoomed in so that you can only see a part of it.
Figure 7.8: A circular sequence as it looks on the screen.
When selecting Export visible area, the exported file will only contain the part of the sequence
that is visible in the view. The result from exporting the view from figure 7.8 and choosing Export
visible area can be seen in figure 7.9.
Figure 7.9: The exported graphics file when selecting Export visible area.
On the other hand, if you select Export whole view, you will get a result that looks like figure 7.10.
This means that the graphics file will also include the part of the sequence which is not visible
when you have zoomed in.
For 3D structures, this first step is omitted and you will always export what is shown in the view
(equivalent to selecting Export visible area).
Click Next when you have chosen which part of the view to export.
7.3.2
Save location and file formats
In this step, you can choose name and save location for the graphics file (see figure 7.11).
CLC Protein Workbench supports the following file formats for graphics export:
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
111
Figure 7.10: The exported graphics file when selecting Export whole view. The whole sequence is
shown, even though the view is zoomed in on a part of the sequence.
Figure 7.11: Location and name for the graphics file.
Format
Portable Network Graphics
JPEG
Tagged Image File
PostScript
Encapsulated PostScript
Portable Document Format
Scalable Vector Graphics
Suffix
.png
.jpg
.tif
.ps
.eps
.pdf
.svg
Type
bitmap
bitmap
bitmap
vector graphics
vector graphics
vector graphics
vector graphics
These formats can be divided into bitmap and vector graphics. The difference between these two
categories is described below:
Bitmap images
In a bitmap image, each dot in the image has a specified color. This implies, that if you zoom in
on the image there will not be enough dots, and if you zoom out there will be too many. In these
cases the image viewer has to interpolate the colors to fit what is actually looked at. A bitmap
image needs to have a high resolution if you want to zoom in. This format is a good choice for
storing images without large shapes (e.g. dot plots). It is also appropriate if you don't have the
need for resizing and editing the image after export.
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
112
Vector graphics
Vector graphic is a collection of shapes. Thus what is stored is e.g. information about where a
line starts and ends, and the color of the line and its width. This enables a given viewer to decide
how to draw the line, no matter what the zoom factor is, thereby always giving a correct image.
This format is good for e.g. graphs and reports, but less usable for e.g. dot plots. If the image is
to be resized or edited, vector graphics are by far the best format to store graphics. If you open
a vector graphics file in an application like e.g. Adobe Illustrator, you will be able to manipulate
the image in great detail.
Graphics files can also be imported into the Navigation Area. However, no kinds of graphics files
can be displayed in CLC Protein Workbench. See section 7.2 for more about importing external
files into CLC Protein Workbench.
7.3.3
Graphics export parameters
When you have specified the name and location to save the graphics file, you can either click
Next or Finish. Clicking Next allows you to set further parameters for the graphics export,
whereas clicking Finish will export using the parameters that you have set last time you made a
graphics export in that file format (if it is the first time, it will use default parameters).
Parameters for bitmap formats
For bitmap files, clicking Next will display the dialog shown in figure 7.12.
Figure 7.12: Parameters for bitmap formats: size of the graphics file.
You can adjust the size (the resolution) of the file to four standard sizes:
• Screen resolution
• Low resolution
• Medium resolution
• High resolution
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
113
The actual size in pixels is displayed in parentheses. An estimate of the memory usage for
exporting the file is also shown. If the image is to be used on computer screens only, a low
resolution is sufficient. If the image is going to be used on printed material, a higher resolution
is necessary to produce a good result.
Parameters for vector formats
For pdf format, clicking Next will display the dialog shown in figure 7.13 (this is only the case if
the graphics is using more than one page).
Figure 7.13: Page setup parameters for vector formats.
The settings for the page setup are shown, and clicking the Page Setup button will display a
dialog where these settings can ba adjusted. This dialog is described in section 6.2.
The page setup is only available if you have selected to export the whole view - if you have chosen
to export the visible area only, the graphics file will be on one page with no headers or footers.
7.3.4
Exporting protein reports
It is possible to export a protein report using the normal Export function (
a pdf file with a table of contents:
Click the report in the Navigation Area | Export (
) which will generate
) in the Toolbar | select pdf
You can also choose to export a protein report using the Export graphics function (
this way you will not get the table of contents.
7.4
), but in
Export graph data points to a file
Data points for graphs displayed along the sequence or along an alignment, mapping or BLAST
result, can be exported to a semicolon-separated text file (csv format). An example of such
a graph is shown in figure 7.14. This graph shows the coverage of reads of a read mapping
(produced with CLC Genomics Workbench).
To export the data points for the graph, right-click the graph and choose Export Graph to
Comma-separated File. Depending on what kind of graph you have selected, different options
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
114
Figure 7.14: A graph displayed along the mapped reads. Right-click the graph to export the data
points to a file.
will be shown: If the graph is covering a set of aligned sequences with a main sequence, such
as read mappings and BLAST results, the dialog shown in figure 7.15 will be displayed. These
kinds of graphs are located under Alignment info in the Side Panel. In all other cases, a normal
file dialog will be shown letting you specify name and location for the file.
Figure 7.15: Choosing to include data points with gaps
In this dialog, select whether you wish to include positions where the main sequence (the
reference sequence for read mappings and the query sequence for BLAST results) has gaps.
If you are exporting e.g. coverage information from a read mapping, you would probably want
to exclude gaps, if you want the positions in the exported file to match the reference (i.e.
chromosome) coordinates. If you export including gaps, the data points in the file no longer
corresponds to the reference coordinates, because each gap will shift the coordinates.
Clicking Next will present a file dialog letting you specify name and location for the file.
The output format of the file is like this:
CHAPTER 7. IMPORT/EXPORT OF DATA AND GRAPHICS
115
"Position";"Value";
"1";"13";
"2";"16";
"3";"23";
"4";"17";
...
7.5
Copy/paste view output
The content of tables, e.g. in reports, folder lists, and sequence lists can be copy/pasted into
different programs, where it can be edited. CLC Protein Workbench pastes the data in tabulator
separated format which is useful if you use programs like Microsoft Word and Excel. There is a
huge number of programs in which the copy/paste can be applied. For simplicity, we include one
example of the copy/paste function from a Folder Content view to Microsoft Excel.
First step is to select the desired elements in the view:
click a line in the Folder Content view | hold Shift-button | press arrow down/up
key
See figure 7.16.
Figure 7.16: Selected elements in a Folder Content view.
When the elements are selected, do the following to copy the selected elements:
right-click one of the selected elements | Edit | Copy (
)
Then:
right-click in the cell A1 | Paste (
)
The outcome might appear unorganized, but with a few operations the structure of the view in
CLC Protein Workbench can be produced. (Except the icons which are replaced by file references
in Excel.)
Note that all tables can also be Exported (
) directly in Excel format.
Chapter 8
History log
Contents
8.1
Element history . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 116
8.1.1
Sharing data with history . . . . . . . . . . . . . . . . . . . . . . . . . . 117
CLC Protein Workbench keeps a log of all operations you make in the program. If e.g. you rename
a sequence, align sequences, create a phylogenetic tree or translate a sequence, you can always
go back and check what you have done. In this way, you are able to document and reproduce
previous operations.
This can be useful in several situations: It can be used for documentation purposes, where
you can specify exactly how your data has been created and modified. It can also be useful if
you return to a project after some time and want to refresh your memory on how the data was
created. Also, if you have performed an analysis and you want to reproduce the analysis on
another element, you can check the history of the analysis which will give you all parameters you
set.
This chapter will describe how to use the History functionality of CLC Protein Workbench.
8.1
Element history
You can view the history of all elements in the Navigation Area except files that are opened in
other programs (e.g. Word and pdf-files). The history starts when the element appears for the
first time in CLC Protein Workbench. To view the history of an element:
Select the element in the Navigation Area | Show (
or If the element is already open | History (
) in the Toolbar | History (
)
) at the bottom left part of the view
This opens a view that looks like the one in figure 8.1.
When opening an element's history is opened, the newest change is submitted in the top of the
view. The following information is available:
• Title. The action that the user performed.
• Date and time. Date and time for the operation. The date and time are displayed according
116
CHAPTER 8. HISTORY LOG
117
Figure 8.1: An element's history.
to your locale settings (see section 5.1).
• User. The user who performed the operation. If you import some data created by another
person in a CLC Workbench, that persons name will be shown.
• Parameters. Details about the action performed. This could be the parameters that was
chosen for an analysis.
• Origins from. This information is usually shown at the bottom of an element's history. Here,
you can see which elements the current element origins from. If you have e.g. created an
alignment of three sequences, the three sequences are shown here. Clicking the element
selects it in the Navigation Area, and clicking the 'history' link opens the element's own
history.
• Comments. By clicking Edit you can enter your own comments regarding this entry in the
history. These comments are saved.
8.1.1
Sharing data with history
The history of an element is attached to that element, which means that exporting an element
in CLC format (*.clc) will export the history too. In this way, you can share folders and files
with others while preserving the history. If an element's history includes source elements (i.e.
if there are elements listed in 'Origins from'), they must also be exported in order to see the
full history. Otherwise, the history will have entries named "Element deleted". An easy way to
export an element with all its source elements is to use the Export Dependent Elements function
described in section 7.1.3.
The history view can be printed. To do so, click the Print icon (
exported as a pdf file:
Select the element in the Navigation Area | Export (
History PDF | Save
). The history can also be
) | in "File of type" choose
Chapter 9
Batching and result handling
Contents
9.1
9.1
How to handle results of analyses . . . . . . . . . . . . . . . . . . . . . . . . 118
9.1.1
Table outputs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 119
9.1.2
Batch log . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 120
How to handle results of analyses
This section will explain how results generated from tools in the Toolbox are handled by CLC
Protein Workbench. Note that this also applies to tools not running in batch mode (see above). All
the analyses in the Toolbox are performed in a step-by-step procedure. First, you select elements
for analyses, and then there are a number of steps where you can specify parameters (some of
the analyses have no parameters, e.g. when translating DNA to RNA). The final step concerns
the handling of the results of the analysis, and it is almost identical for all the analyses so we
explain it in this section in general.
Figure 9.1: The last step of the analyses exemplified by Translate DNA to RNA.
In this step, shown in figure 9.1, you have two options:
118
CHAPTER 9. BATCHING AND RESULT HANDLING
119
• Open. This will open the result of the analysis in a view. This is the default setting.
• Save. This means that the result will not be opened but saved to a folder in the Navigation
Area. If you select this option, click Next and you will see one more step where you can
specify where to save the results (see figure 9.2). In this step, you also have the option of
creating a new folder or adding a location by clicking the buttons ( )/ ( ) at the top of
the dialog.
Figure 9.2: Specify a folder for the results of the analysis.
9.1.1
Table outputs
Some analyses also generate a table with results, and for these analyses the last step looks like
figure 9.3.
Figure 9.3: Analyses which also generate tables.
In addition to the Open and Save options you can also choose whether the result of the analysis
should be added as annotations on the sequence or shown on a table. If both options are
selected, you will be able to click the results in the table and the corresponding region on the
sequence will be selected.
CHAPTER 9. BATCHING AND RESULT HANDLING
120
If you choose to add annotations to the sequence, they can be removed afterwards by clicking
Undo ( ) in the Toolbar.
9.1.2
Batch log
For some analyses, there is an extra option in the final step to create a log of the batch process
(see e.g. figure 9.3). This log will be created in the beginning of the process and continually
updated with information about the results. See an example of a log in figure 9.4. In this
example, the log displays information about how many open reading frames were found.
Figure 9.4: An example of a batch log when finding open reading frames.
The log will either be saved with the results of the analysis or opened in a view with the results,
depending on how you chose to handle the results.
Part III
Bioinformatics
121
Chapter 10
Viewing and editing sequences
Contents
10.1 View sequence . . . . . . . . . . . . . . . . . . . . . . . .
10.1.1 Sequence settings in Side Panel . . . . . . . . . . . .
10.1.2 Restriction sites in the Side Panel . . . . . . . . . . .
10.1.3 Selecting parts of the sequence . . . . . . . . . . . .
10.1.4 Editing the sequence . . . . . . . . . . . . . . . . . .
10.1.5 Sequence region types . . . . . . . . . . . . . . . . .
10.2 Circular DNA . . . . . . . . . . . . . . . . . . . . . . . . . .
10.2.1 Using split views to see details of the circular molecule
10.2.2 Mark molecule as circular and specify starting point . .
10.3 Working with annotations . . . . . . . . . . . . . . . . . .
10.3.1 Viewing annotations . . . . . . . . . . . . . . . . . . .
10.3.2 Adding annotations . . . . . . . . . . . . . . . . . . .
10.3.3 Edit annotations . . . . . . . . . . . . . . . . . . . . .
10.3.4 Removing annotations . . . . . . . . . . . . . . . . . .
10.4 Element information . . . . . . . . . . . . . . . . . . . . . .
10.5 View as text . . . . . . . . . . . . . . . . . . . . . . . . . .
10.6 Creating a new sequence . . . . . . . . . . . . . . . . . . .
10.7 Sequence Lists . . . . . . . . . . . . . . . . . . . . . . . .
10.7.1 Graphical view of sequence lists . . . . . . . . . . . .
10.7.2 Sequence list table . . . . . . . . . . . . . . . . . . .
10.7.3 Extract sequences . . . . . . . . . . . . . . . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
122
123
129
129
130
130
130
132
132
133
133
137
139
140
141
142
142
143
144
144
145
CLC Protein Workbench offers five different ways of viewing and editing single sequences as
described in the first five sections of this chapter. Furthermore, this chapter also explains how
to create a new sequence and how to gather several sequences in a sequence list.
10.1
View sequence
When you double-click a sequence in the Navigation Area, the sequence will open automatically,
and you will see the nucleotides or amino acids. The zoom options described in section 3.3 allow
122
CHAPTER 10. VIEWING AND EDITING SEQUENCES
123
you to e.g. zoom out in order to see more of the sequence in one view. There are a number
of options for viewing and editing the sequence which are all described in this section. All the
options described in this section also apply to alignments (further described in section 18.2).
10.1.1
Sequence settings in Side Panel
Each view of a sequence has a Side Panel located at the right side of the view (see figure 10.1.
Figure 10.1: Overview of the Side Panel which is always shown to the right of a view.
When you make changes in the Side Panel the view of the sequence is instantly updated. To
show or hide the Side Panel:
select the View | Ctrl + U
or Click the ( ) at the top right corner of the Side Panel to hide | Click the gray
Side Panel button to the right to show
Below, each group of settings will be explained. Some of the preferences are not the same
for nucleotide and protein sequences, but the differences will be explained for each group of
settings.
Note! When you make changes to the settings in the Side Panel, they are not automatically
saved when you save the sequence. Click Save/restore Settings ( ) to save the settings (see
section 5.5 for more information).
Sequence Layout
These preferences determine the overall layout of the sequence:
• Spacing. Inserts a space at a specified interval:
No spacing. The sequence is shown with no spaces.
Every 10 residues. There is a space every 10 residues, starting from the beginning of
the sequence.
Every 3 residues, frame 1. There is a space every 3 residues, corresponding to the
reading frame starting at the first residue.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
124
Every 3 residues, frame 2. There is a space every 3 residues, corresponding to the
reading frame starting at the second residue.
Every 3 residues, frame 3. There is a space every 3 residues, corresponding to the
reading frame starting at the third residue.
• Wrap sequences. Shows the sequence on more than one line.
No wrap. The sequence is displayed on one line.
Auto wrap. Wraps the sequence to fit the width of the view, not matter if it is zoomed
in our out (displays minimum 10 nucleotides on each line).
Fixed wrap. Makes it possible to specify when the sequence should be wrapped. In
the text field below, you can choose the number of residues to display on each line.
• Double stranded. Shows both strands of a sequence (only applies to DNA sequences).
• Numbers on sequences. Shows residue positions along the sequence. The starting point
can be changed by setting the number in the field below. If you set it to e.g. 101, the first
residue will have the position of -100. This can also be done by right-clicking an annotation
and choosing Set Numbers Relative to This Annotation.
• Numbers on plus strand. Whether to set the numbers relative to the positive or the negative
strand in a nucleotide sequence (only applies to DNA sequences).
• Follow selection. When viewing the same sequence in two separate views, "Follow
selection" will automatically scroll the view in order to follow a selection made in the other
view.
• Lock numbers. When you scroll vertically, the position numbers remain visible. (Only
possible when the sequence is not wrapped.)
• Lock labels. When you scroll horizontally, the label of the sequence remains visible.
• Sequence label. Defines the label to the left of the sequence.
Name (this is the default information to be shown).
Accession (sequences downloaded from databases like GenBank have an accession
number).
Latin name.
Latin name (accession).
Common name.
Common name (accession).
Annotation Layout and Annotation Types
See section 10.3.1.
Restriction sites
See section 10.1.2.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
125
Motifs
See section 14.7.1.
Residue coloring
These preferences make it possible to color both the residue letter and set a background color
for the residue.
• Non-standard residues. For nucleotide sequences this will color the residues that are not
C, G, A, T or U. For amino acids only B, Z, and X are colored as non-standard residues.
Foreground color. Sets the color of the letter. Click the color box to change the color.
Background color. Sets the background color of the residues. Click the color box to
change the color.
• Rasmol colors. Colors the residues according to the Rasmol color scheme.
See http://www.openrasmol.org/doc/rasmol.html
Foreground color. Sets the color of the letter. Click the color box to change the color.
Background color. Sets the background color of the residues. Click the color box to
change the color.
• Polarity colors (only protein). Colors the residues according to the polarity of amino acids.
Foreground color. Sets the color of the letter. Click the color box to change the color.
Background color. Sets the background color of the residues. Click the color box to
change the color.
• Trace colors (only DNA). Colors the residues according to the color conventions of
chromatogram traces: A=green, C=blue, G=black, and T=red.
Foreground color. Sets the color of the letter.
Background color. Sets the background color of the residues.
Nucleotide info
These preferences only apply to nucleotide sequences.
• Translation. Displays a translation into protein just below the nucleotide sequence.
Depending on the zoom level, the amino acids are displayed with three letters or one letter.
Frame. Determines where to start the translation.
∗ ORF/CDS. If the sequence is annotated, the translation will follow the CDS or ORF
annotations. If annotations overlap, only one translation will be shown. If only one
annotation is visible, the Workbench will attempt to use this annotation to mark
the start and stop for the translation. In cases where this is not possible, the first
annotation will be used (i.e. the one closest to the 5' end of the sequence).
CHAPTER 10. VIEWING AND EDITING SEQUENCES
126
∗ Selection. This option will only take effect when you make a selection on the
sequence. The translation will start from the first nucleotide selected. Making a
new selection will automatically display the corresponding translation. Read more
about selecting in section 10.1.3.
∗ +1 to -1. Select one of the six reading frames.
∗ All forward/All reverse. Shows either all forward or all reverse reading frames.
∗ All. Select all reading frames at once. The translations will be displayed on top of
each other.
Table. The translation table to use in the translation. For more about translation
tables, see section 15.5.
Only AUG start codons. For most genetic codes, a number of codons can be start
codons. Selecting this option only colors the AUG codons green.
Single letter codes. Choose to represent the amino acids with a single letter instead
of three letters.
• G/C content. Calculates the G/C content of a part of the sequence and shows it as a
gradient of colors or as a graph below the sequence.
Window length. Determines the length of the part of the sequence to calculate. A
window length of 9 will calculate the G/C content for the nucleotide in question plus
the 4 nucleotides to the left and the 4 nucleotides to the right. A narrow window will
focus on small fluctuations in the G/C content level, whereas a wider window will show
fluctuations between larger parts of the sequence.
Foreground color. Colors the letter using a gradient, where the left side color is used
for low levels of G/C content and the right side color is used for high levels of G/C
content. The sliders just above the gradient color box can be dragged to highlight
relevant levels of G/C content. The colors can be changed by clicking the box. This
will show a list of gradients to choose from.
Background color. Sets a background color of the residues using a gradient in the
same way as described above.
Graph. The G/C content level is displayed on a graph (Learn how to export the data
behind the graph in section 7.4).
∗ Height. Specifies the height of the graph.
∗ Type. The graph can be displayed as Line plot, Bar plot or as a Color bar.
∗ Color box. For Line and Bar plots, the color of the plot can be set by clicking
the color box. For Colors, the color box is replaced by a gradient color box as
described under Foreground color.
Protein info
These preferences only apply to proteins. The first nine items are different hydrophobicity scales
and are described in section 16.5.2.
• Kyte-Doolittle. The Kyte-Doolittle scale is widely used for detecting hydrophobic regions
in proteins. Regions with a positive value are hydrophobic. This scale can be used for
identifying both surface-exposed regions as well as transmembrane regions, depending
on the window size used. Short window sizes of 5-7 generally work well for predicting
CHAPTER 10. VIEWING AND EDITING SEQUENCES
127
putative surface-exposed regions. Large window sizes of 19-21 are well suited for finding
transmembrane domains if the values calculated are above 1.6 [Kyte and Doolittle, 1982].
These values should be used as a rule of thumb and deviations from the rule may occur.
• Cornette. Cornette et al. computed an optimal hydrophobicity scale based on 28 published
scales [Cornette et al., 1987]. This optimized scale is also suitable for prediction of
alpha-helices in proteins.
• Engelman. The Engelman hydrophobicity scale, also known as the GES-scale, is another
scale which can be used for prediction of protein hydrophobicity [Engelman et al., 1986].
As the Kyte-Doolittle scale, this scale is useful for predicting transmembrane regions in
proteins.
• Eisenberg. The Eisenberg scale is a normalized consensus hydrophobicity scale which
shares many features with the other hydrophobicity scales [Eisenberg et al., 1984].
• Rose. The hydrophobicity scale by Rose et al. is correlated to the average area of buried
amino acids in globular proteins [Rose et al., 1985]. This results in a scale which is not
showing the helices of a protein, but rather the surface accessibility.
• Janin. This scale also provides information about the accessible and buried amino acid
residues of globular proteins [Janin, 1979].
• Hopp-Woods. Hopp and Woods developed their hydrophobicity scale for identification of
potentially antigenic sites in proteins. This scale is basically a hydrophilic index where
apolar residues have been assigned negative values. Antigenic sites are likely to be
predicted when using a window size of 7 [Hopp and Woods, 1983].
• Welling. [Welling et al., 1985] Welling et al. used information on the relative occurrence of
amino acids in antigenic regions to make a scale which is useful for prediction of antigenic
regions. This method is better than the Hopp-Woods scale of hydrophobicity which is also
used to identify antigenic regions.
• Kolaskar-Tongaonkar. A semi-empirical method for prediction of antigenic regions has been
developed [Kolaskar and Tongaonkar, 1990]. This method also includes information of
surface accessibility and flexibility and at the time of publication the method was able to
predict antigenic determinants with an accuracy of 75%.
• Surface Probability. Display of surface probability based on the algorithm by [Emini et al.,
1985]. This algorithm has been used to identify antigenic determinants on the surface of
proteins.
• Chain Flexibility. Display of backbone chain flexibility based on the algorithm by [Karplus
and Schulz, 1985]. It is known that chain flexibility is an indication of a putative antigenic
determinant.
Find
The Find function can also be invoked by pressing Ctrl + Shift + F (
+ Shift + F on Mac).
The Find function can be used for searching the sequence. Clicking the find button will search for
the first occurrence of the search term. Clicking the find button again will find the next occurrence
and so on. If the search string is found, the corresponding part of the sequence will be selected.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
128
• Search term. Enter the text to search for. The search function does not discriminate
between lower and upper case characters.
• Sequence search. Search the nucleotides or amino acids. For amino acids, the single
letter abbreviations should be used for searching. The sequence search also has a set of
advanced search parameters:
Include negative strand. This will search on the negative strand as well.
Treat ambiguous characters as wildcards in search term. If you search for e.g. ATN,
you will find both ATG and ATC. If you wish to find literally exact matches for ATN (i.e.
only find ATN - not ATG), this option should not be selected.
Treat ambiguous characters as wildcards in sequence. If you search for e.g. ATG, you
will find both ATG and ATN. If you have large regions of Ns, this option should not be
selected.
Note that if you enter a position instead of a sequence, it will automatically switch to
position search.
• Annotation search. Searches the annotations on the sequence. The search is performed
both on the labels of the annotations, but also on the text appearing in the tooltip that you
see when you keep the mouse cursor fixed. If the search term is found, the part of the
sequence corresponding to the matching annotation is selected. Below this option you can
choose to search for translations as well. Sequences annotated with coding regions often
have the translation specified which can lead to undesired results.
• Position search. Finds a specific position on the sequence. In order to find an interval, e.g.
from position 500 to 570, enter "500..570" in the search field. This will make a selection
from position 500 to 570 (both included). Notice the two periods (..) between the start an
end number (see section 10.3.2). If you enter positions including thousands separators like
123,345, the comma will just be ignored and it would be equivalent to entering 123345.
• Include negative strand. When searching the sequence for nucleotides or amino acids, you
can search on both strands.
• Name search. Searches for sequence names. This is useful for searching sequence lists,
mapping results and BLAST results.
This concludes the description of the View Preferences. Next, the options for selecting and
editing sequences are described.
Text format
These preferences allow you to adjust the format of all the text in the view (both residue letters,
sequence name and translations if they are shown).
• Text size. Five different sizes.
• Font. Shows a list of Fonts available on your computer.
• Bold residues. Makes the residues bold.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
10.1.2
129
Restriction sites in the Side Panel
Please see section 17.1.
10.1.3
Selecting parts of the sequence
You can select parts of a sequence:
Click Selection ( ) in Toolbar | Press and hold down the mouse button on the
sequence where you want the selection to start | move the mouse to the end of
the selection while holding the button | release the mouse button
Alternatively, you can search for a specific interval using the find function described above.
If you have made a selection and wish to adjust it:
drag the edge of the selection (you can see the mouse cursor change to a horizontal
arrow
or press and hold the Shift key while using the right and left arrow keys to adjust the
right side of the selection.
If you wish to select the entire sequence:
double-click the sequence name to the left
Selecting several parts at the same time (multiselect)
You can select several parts of sequence by holding down the Ctrl button while making selections.
Holding down the Shift button lets you extend or reduce an existing selection to the position you
clicked.
To select a part of a sequence covered by an annotation:
right-click the annotation | Select annotation
or double-click the annotation
To select a fragment between two restriction sites that are shown on the sequence:
double-click the sequence between the two restriction sites
(Read more about restriction sites in section 10.1.2.)
Open a selection in a new view
A selection can be opened in a new view and saved as a new sequence:
right-click the selection | Open selection in New View (
)
This opens the annotated part of the sequence in a new view. The new sequence can be saved
by dragging the tab of the sequence view into the Navigation Area.
The process described above is also the way to manually translate coding parts of sequences
(CDS) into protein. You simply translate the new sequence into protein. This is done by:
right-click the tab of the new sequence | Toolbox | Nucleotide Analyses (
Translate to Protein ( )
) |
CHAPTER 10. VIEWING AND EDITING SEQUENCES
130
A selection can also be copied to the clipboard and pasted into another program:
make a selection | Ctrl + C (
+ C on Mac)
Note! The annotations covering the selection will not be copied.
A selection of a sequence can be edited as described in the following section.
10.1.4
Editing the sequence
When you make a selection, it can be edited by:
right-click the selection | Edit Selection (
)
A dialog appears displaying the sequence. You can add, remove or change the text and click
OK. The original selected part of the sequence is now replaced by the sequence entered in the
dialog. This dialog also allows you to paste text into the sequence using Ctrl + V ( + V on Mac).
If you delete the text in the dialog and press OK, the selected text on the sequence will also be
deleted. Another way to delete a part of the sequence is to:
right-click the selection | Delete Selection (
)
If you wish to only correct only one residue, this is possible by simply making the selection only
cover one residue and then type the new residue.
10.1.5
Sequence region types
The various annotations on sequences cover parts of the sequence. Some cover an interval,
some cover intervals with unknown endpoints, some cover more than one interval etc. In the
following, all of these will be referred to as regions. Regions are generally illustrated by markings
(often arrows) on the sequences. An arrow pointing to the right indicates that the corresponding
region is located on the positive strand of the sequence. Figure 10.2 is an example of three
regions with separate colors.
Figure 10.2: Three regions on a human beta globin DNA sequence (HUMHBB).
Figure 10.3 shows an artificial sequence with all the different kinds of regions.
10.2
Circular DNA
A sequence can be shown as a circular molecule:
select a sequence in the Navigation Area | Show in the Toolbar | As Circular (
)
or If the sequence is already open | Click Show As Circular ( ) at the lower left part
of the view
This will open a view of the molecule similar to the one in figure 10.4.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
131
Figure 10.3: Region #1: A single residue, Region #2: A range of residues including both endpoints,
Region #3: A range of residues starting somewhere before 30 and continuing up to and including
40, Region #4: A single residue somewhere between 50 and 60 inclusive, Region #5: A range of
residues beginning somewhere between 70 and 80 inclusive and ending at 90 inclusive, Region #6:
A range of residues beginning somewhere between 100 and 110 inclusive and ending somewhere
between 120 and 130 inclusive, Region #7: A site between residues 140 and 141, Region #8:
A site between two residues somewhere between 150 and 160 inclusive, Region #9: A region
that covers ranges from 170 to 180 inclusive and 190 to 200 inclusive, Region #10: A region on
negative strand that covers ranges from 210 to 220 inclusive, Region #11: A region on negative
strand that covers ranges from 230 to 240 inclusive and 250 to 260 inclusive.
Figure 10.4: A molecule shown in a circular view.
This view of the sequence shares some of the properties of the linear view of sequences as
described in section 10.1, but there are some differences. The similarities and differences are
listed below:
• Similarities:
The editing options.
Options for adding, editing and removing annotations.
Restriction Sites, Annotation Types, Find and Text Format preferences groups.
• Differences:
CHAPTER 10. VIEWING AND EDITING SEQUENCES
132
In the Sequence Layout preferences, only the following options are available in the
circular view: Numbers on plus strand, Numbers on sequence and Sequence label.
You cannot zoom in to see the residues in the circular molecule. If you wish to see
these details, split the view with a linear view of the sequence
In the Annotation Layout, you also have the option of showing the labels as Stacked.
This means that there are no overlapping labels and that all labels of both annotations
and restriction sites are adjusted along the left and right edges of the view.
10.2.1
Using split views to see details of the circular molecule
In order to see the nucleotides of a circular molecule you can open a new view displaying a
circular view of the molecule:
Press and hold the Ctrl button (
on Mac) | click Show Sequence ( ) at the
bottom of the view
This will open a linear view of the sequence below the circular view. When you zoom in on the
linear view you can see the residues as shown in figure 10.5.
Figure 10.5: Two views showing the same sequence. The bottom view is zoomed in.
Note! If you make a selection in one of the views, the other view will also make the corresponding
selection, providing an easy way for you to focus on the same region in both views.
10.2.2
Mark molecule as circular and specify starting point
You can mark a DNA molecule as circular by right-clicking its name in either the sequence view or
the circular view. In the right-click menu you can also make a circular molecule linear. A circular
molecule displayed in the normal sequence view, will have the sequence ends marked with a .
The starting point of a circular sequence can be changed by:
make a selection starting at the position that you want to be the new starting
point | right-click the selection | Move Starting Point to Selection Start
Note! This can only be done for sequence that have been marked as circular.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
10.3
133
Working with annotations
Annotations provide information about specific regions of a sequence. A typical example is the
annotation of a gene on a genomic DNA sequence.
Annotations derive from different sources:
• Sequences downloaded from databases like GenBank are annotated.
• In some of the data formats that can be imported into CLC Protein Workbench, sequences
can have annotations (GenBank, EMBL and Swiss-Prot format).
• The result of a number of analyses in CLC Protein Workbench are annotations on the
sequence (e.g. finding open reading frames and restriction map analysis).
• You can manually add annotations to a sequence (described in the section 10.3.2).
Note! Annotations are included if you export the sequence in GenBank, Swiss-Prot, EMBL or CLC
format. When exporting in other formats, annotations are not preserved in the exported file.
10.3.1
Viewing annotations
Annotations can be viewed in a number of different ways:
• As arrows or boxes in the sequence views:
Linear and circular view of sequences (
Alignments (
)/ (
).
).
Graphical view of sequence lists (
).
BLAST views (only the query sequence at the top can have annotations) (
• In the table of annotations (
).
).
• In the text view of sequences (
)
In the following sections, these view options will be described in more detail.
In all the views except the text view (
is described in the following sections.
), annotations can be added, modified and deleted. This
View Annotations in sequence views
Figure 10.6 shows an annotation displayed on a sequence.
The various sequence views listed in section 10.3.1 have different default settings for showing
annotations. However, they all have two groups in the Side Panel in common:
• Annotation Layout
• Annotation Types
CHAPTER 10. VIEWING AND EDITING SEQUENCES
134
Figure 10.6: An annotation showing a coding region on a genomic dna sequence.
Figure 10.7: Changing the layout of annotations in the Side Panel.
The two groups are shown in figure 10.7.
In the Annotation layout group, you can specify how the annotations should be displayed (notice
that there are some minor differences between the different sequence views):
• Show annotations. Determines whether the annotations are shown.
• Position.
On sequence. The annotations are placed on the sequence. The residues are visible
through the annotations (if you have zoomed in to 100%).
CHAPTER 10. VIEWING AND EDITING SEQUENCES
135
Next to sequence. The annotations are placed above the sequence.
Separate layer. The annotations are placed above the sequence and above restriction
sites (only applicable for nucleotide sequences).
• Offset. If several annotations cover the same part of a sequence, they can be spread out.
Piled. The annotations are piled on top of each other. Only the one at front is visible.
Little offset. The annotations are piled on top of each other, but they have been offset
a little.
More offset. Same as above, but with more spreading.
Most offset. The annotations are placed above each other with a little space between.
This can take up a lot of space on the screen.
• Label. The name of the annotation can shown as a label. Additional information about the
sequence is shown if you place the mouse cursor on the annotation and keep it still.
No labels. No labels are displayed.
On annotation. The labels are displayed in the annotation's box.
Over annotation. The labels are displayed above the annotations.
Before annotation. The labels are placed just to the left of the annotation.
Flag. The labels are displayed as flags at the beginning of the annotation.
Stacked. The labels are offset so that the text of all labels is visible. This means that
there is varying distance between each sequence line to make room for the labels.
• Show arrows. Displays the end of the annotation as an arrow. This can be useful to see
the orientation of the annotation (for DNA sequences). Annotations on the negative strand
will have an arrow pointing to the left.
• Use gradients. Fills the boxes with gradient color.
In the Annotation Types group, you can choose which kinds of annotations that should be
displayed. This group lists all the types of annotations that are attached to the sequence(s) in the
view. For sequences with many annotations, it can be easier to get an overview if you deselect
the annotation types that are not relevant.
Unchecking the checkboxes in the Annotation Layout will not remove this type of annotations
them from the sequence - it will just hide them from the view.
Besides selecting which types of annotations that should be displayed, the Annotation Types
group is also used to change the color of the annotations on the sequence. Click the colored
square next to the relevant annotation type to change the color.
This will display a dialog with three tabs: Swatches, HSB, and RGB. They represent three different
ways of specifying colors. Apply your settings and click OK. When you click OK, the color settings
cannot be reset. The Reset function only works for changes made before pressing OK.
Furthermore, the Annotation Types can be used to easily browse the annotations by clicking the
small button ( ) next to the type. This will display a list of the annotations of that type (see
figure 10.8).
Clicking an annotation in the list will select this region on the sequence. In this way, you can
quickly find a specific annotation on a long sequence.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
136
Figure 10.8: Browsing the gene annotations on a sequence.
View Annotations in a table
Annotations can also be viewed in a table:
select the sequence in the Navigation Area | Show (
) | Annotation Table (
or If the sequence is already open | Click Show Annotation Table (
left part of the view
)
) at the lower
This will open a view similar to the one in figure 10.9).
Figure 10.9: A table showing annotations on the sequence.
In the Side Panel you can show or hide individual annotation types in the table. E.g. if you
only wish to see "gene" annotations, de-select the other annotation types so that only "gene" is
selected.
Each row in the table is an annotation which is represented with the following information:
• Name.
• Type.
• Region.
• Qualifiers.
The Name, Type and Region for each annotation can be edited simply by double-clicking, typing
the change directly, and pressing Enter.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
137
This information corresponds to the information in the dialog when you edit and add annotations
(see section 10.3.2).
You can benefit from this table in several ways:
• It provides an intelligible overview of all the annotations on the sequence.
• You can use the filter at the top to search the annotations. Type e.g. "UCP" into the filter
and you will find all annotations which have "UCP" in either the name, the type, the region
or the qualifiers. Combined with showing or hiding the annotation types in the Side Panel,
this makes it easy to find annotations or a subset of annotations.
• You can copy and paste annotations, e.g. from one sequence to another.
• If you wish to edit many annotations consecutively, the double-click editing makes this very
fast (see section 10.3.2).
10.3.2
Adding annotations
Adding annotations to a sequence can be done in two ways:
open the sequence in a sequence view (double-click in the Navigation Area) | make
a selection covering the part of the sequence you want to annotate1 | right-click
the selection | Add Annotation ( )
or select the sequence in the Navigation Area | Show (
Annotation ( )
) | Annotations (
) | Add
This will display a dialog like the one in figure 10.10.
Figure 10.10: The Add Annotation dialog.
The left-hand part of the dialog lists a number of Annotation types. When you have selected an
annotation type, it appears in Type to the right. You can also select an annotation directly in this
CHAPTER 10. VIEWING AND EDITING SEQUENCES
138
list. Choosing an annotation type is mandatory. If you wish to use an annotation type which is
not present in the list, simply enter this type into the Type field 2 .
The right-hand part of the dialog contains the following text fields:
• Name. The name of the annotation which can be shown on the label in the sequence views.
(Whether the name is actually shown depends on the Annotation Layout preferences, see
section 10.3.1).
• Type. Reflects the left-hand part of the dialog as described above. You can also choose
directly in this list or type your own annotation type.
• Region. If you have already made a selection, this field will show the positions of
the selection. You can modify the region further using the conventions of DDBJ, EMBL
and GenBank. The following are examples of how to use the syntax (based on http:
//www.ncbi.nlm.nih.gov/collab/FT/):
467. Points to a single residue in the presented sequence.
340..565. Points to a continuous range of residues bounded by and including the
starting and ending residues.
<345..500. Indicates that the exact lower boundary point of a region is unknown. The
location begins at some residue previous to the first residue specified (which is not
necessarily contained in the presented sequence) and continues up to and including
the ending residue.
<1..888. The region starts before the first sequenced residue and continues up to
and including residue 888.
1..>888. The region starts at the first sequenced residue and continues beyond
residue 888.
(102.110). Indicates that the exact location is unknown, but that it is one of the
residues between residues 102 and 110, inclusive.
123 124. Points to a site between residues 123 and 124.
join(12..78,134..202). Regions 12 to 78 and 134 to 202 should be joined to form
one contiguous sequence.
complement(34..126) Start at the residue complementary to 126 and finish at the
residue complementary to residue 34 (the region is on the strand complementary to
the presented strand).
complement(join(2691..4571,4918..5163)). Joins regions 2691 to 4571 and 4918
to 5163, then complements the joined segments (the region is on the strand
complementary to the presented strand).
join(complement(4918..5163),complement(2691..4571)). Complements regions
4918 to 5163 and 2691 to 4571, then joins the complemented segments (the
region is on the strand complementary to the presented strand).
• Annotations. In this field, you can add more information about the annotation like comments
and links. Click the Add qualifier/key button to enter information. Select a qualifier which
2
Note that your own annotation types will be converted to "unsure" when exporting in GenBank format. As long as
you use the sequence in CLC format, you own annotation type will be preserved
CHAPTER 10. VIEWING AND EDITING SEQUENCES
139
describes the kind of information you wish to add. If an appropriate qualifier is not present
in the list, you can type your own qualifier. The pre-defined qualifiers are derived from
the GenBank format. You can add as many qualifier/key lines as you wish by clicking the
button. Redundant lines can be removed by clicking the delete icon ( ). The information
entered on these lines is shown in the annotation table (see section 10.3.1) and in the
yellow box which appears when you place the mouse cursor on the annotation. If you write
a hyperlink in the Key text field, like e.g. "www.clcbio.com", it will be recognized as a
hyperlink. Clicking the link in the annotation table will open a web browser.
Click OK to add the annotation.
Note! The annotation will be included if you export the sequence in GenBank, Swiss-Prot or CLC
format. When exporting in other formats, annotations are not preserved in the exported file.
10.3.3
Edit annotations
To edit an existing annotation from within a sequence view:
right-click the annotation | Edit Annotation (
)
This will show the same dialog as in figure 10.10, with the exception that some of the fields are
filled out depending on how much information the annotation contains.
There is another way of quickly editing annotations which is particularly useful when you wish to
edit several annotations.
To edit the information, simply double-click and you will be able to edit e.g. the name or the
annotation type. If you wish to edit the qualifiers and double-click in this column, you will see the
dialog for editing annotations.
Advanced editing of annotations
Sometimes you end up with annotations which do not have a meaningful name. In that case
there is an advanced batch rename functionality:
Open the Annotation Table ( ) | select the annotations that you want to rename |
right-click the selection | Advanced Rename
This will bring up the dialog shown in figure 10.11.
Figure 10.11: The Advanced Rename dialog.
In this dialog, you have two options:
CHAPTER 10. VIEWING AND EDITING SEQUENCES
140
• Use this qualifier. Use one of the qualifiers as name. A list of all qualifiers of all the
selected annotations is shown. Note that if one of the annotations do not have the qualifier
you have chosen, it will not be renamed. If an annotation has multiple qualifiers of the
same type, the first is used for naming.
• Use annotation type as name. The annotation's type will be used as name (e.g. if you have
an annotation of type "Promoter", it will get "Promoter" as its name by using this option).
A similar functionality is available for batch re-typing annotations is available in the right-click
menu as well, in case your annotations are not typed correctly:
Open the Annotation Table ( ) | select the annotations that you want to retype |
right-click the selection | Advanced Retype
This will bring up the dialog shown in figure 10.12.
Figure 10.12: The Advanced Retype dialog.
In this dialog, you have two options:
• Use this qualifier. Use one of the qualifiers as type. A list of all qualifiers of all the selected
annotations is shown. Note that if one of the annotations do not have the qualifier you have
chosen, it will not be retyped. If an annotation has multiple qualifiers of the same type, the
first is used for the new type.
• New type. You can select from a list of all the pre-defined types as well as enter your own
annotation type. All the selected annotations will then get this type.
• Use annotation name as type. The annotation's name will be used as type (e.g. if you have
an annotation named "Promoter", it will get "Promoter" as its type by using this option).
10.3.4
Removing annotations
Annotations can be hidden using the Annotation Types preferences in the Side Panel to the right
of the view (see section 10.3.1). In order to completely remove the annotation:
right-click the annotation | Delete | Delete Annotation (
)
If you want to remove all annotations of one type:
right-click an annotation of the type you want to remove | Delete | Delete Annotations of Type "type"
If you want to remove all annotations from a sequence:
CHAPTER 10. VIEWING AND EDITING SEQUENCES
141
right-click an annotation | Delete | Delete All Annotations
The removal of annotations can be undone using Ctrl + Z or Undo (
) in the Toolbar.
If you have more sequences (e.g. in a sequence list, alignment or contig), you have two additional
options:
right-click an annotation | Delete | Delete All Annotations from All Sequences
right-click an annotation | Delete | Delete Annotations of Type "type" from All
Sequences
10.4
Element information
The normal view of a sequence (by double-clicking) shows the annotations as boxes along the
sequence, but often there is more information available about sequences. This information is
available through the Element info view.
To view the sequence information:
select a sequence in the Navigation Area | Show (
( )
) in the Toolbar | Element info
This will display a view similar to fig 10.13.
Figure 10.13: The initial display of sequence info for the HUMHBB DNA sequence from the Example
data.
All the lines in the view are headings, and the corresponding text can be shown by clicking the
text.
• Name. The name of the sequence which is also shown in sequence views and in the
Navigation Area.
• Description. A description of the sequence.
• Comments. The author's comments about the sequence.
• Keywords. Keywords describing the sequence.
• Db source. Accession numbers in other databases concerning the same sequence.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
142
• Gb Division. Abbreviation of GenBank divisions. See section 3.3 in the GenBank release
notes for a full list of GenBank divisions.
• Length. The length of the sequence.
• Modification date. Modification date from the database. This means that this date does
not reflect your own changes to the sequence. See the history (section 8) for information
about the latest changes to the sequence after it was downloaded from the database.
• Organism. Scientific name of the organism (first line) and taxonomic classification levels
(second and subsequent lines).
The information available depends on the origin of the sequence. Sequences downloaded from
database like NCBI and UniProt (see section 12) have this information. On the other hand, some
sequence formats like fasta format do not contain this information.
Some of the information can be edited by clicking the blue Edit text. This means that you can
add your own information to sequences that do not derive from databases.
Note that for other kinds of data, the Element info will only have Name and Description.
10.5
View as text
A sequence can be viewed as text without any layout and text formatting. This displays all the
information about the sequence in the GenBank file format. To view a sequence as text:
select a sequence in the Navigation Area | Show in the Toolbar | As text
This way it is possible to see background information about e.g. the authors and the origin of
DNA and protein sequences. Selections or the entire text of the Sequence Text View can be
copied and pasted into other programs:
Much of the information is also displayed in the Sequence info, where it is easier to get an
overview (see section 10.4.)
In the Side Panel, you find a search field for searching the text in the view.
10.6
Creating a new sequence
A sequence can either be imported, downloaded from an online database or created in the CLC
Protein Workbench. This section explains how to create a new sequence:
New (
) in the toolbar
The Create Sequence dialog (figure 10.14) reflects the information needed in the GenBank
format, but you are free to enter anything into the fields. The following description is a guideline
for entering information about a sequence:
• Name. The name of the sequence. This is used for saving the sequence.
• Common name. A common name for the species.
• Latin name. The Latin name for the species.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
143
Figure 10.14: Creating a sequence.
• Type. Select between DNA, RNA and protein.
• Circular. Specifies whether the sequence is circular. This will open the sequence in a
circular view as default. (applies only to nucleotide sequences).
• Description. A description of the sequence.
• Keywords. A set of keywords separated by semicolons (;).
• Comments. Your own comments to the sequence.
• Sequence. Depending on the type chosen, this field accepts nucleotides or amino acids.
Spaces and numbers can be entered, but they are ignored when the sequence is created.
This allows you to paste (Ctrl + V on Windows and
+ V on Mac) in a sequence directly
from a different source, even if the residue numbers are included. Characters that are not
part of the IUPAC codes cannot be entered. At the top right corner of the field, the number
of residues are counted. The counter does not count spaces or numbers.
Clicking Finish opens the sequence. It can be saved by clicking Save (
of the sequence view into the Navigation Area.
10.7
) or by dragging the tab
Sequence Lists
The Sequence List shows a number of sequences in a tabular format or it can show the
sequences together in a normal sequence view.
Having sequences in a sequence list can help organizing sequence data. The sequence list
may originate from an NCBI search (chapter 11.1). Moreover, if a multiple sequence fasta file
is imported, it is possible to store the data in a sequences list. A Sequence List can also be
generated using a dialog, which is described here:
select two or more sequences | right-click the elements | New | Sequence List (
This action opens a Sequence List dialog:
)
CHAPTER 10. VIEWING AND EDITING SEQUENCES
144
Figure 10.15: A Sequence List dialog.
The dialog allows you to select more sequences to include in the list, or to remove already
chosen sequences from the list.
Clicking Finish opens the sequence list. It can be saved by clicking Save (
tab of the view into the Navigation Area.
) or by dragging the
Opening a Sequence list is done by:
right-click the sequence list in the Navigation Area | Show (
List ( ) OR Table ( )
) | Graphical Sequence
The two different views of the same sequence list are shown in split screen in figure 10.16.
10.7.1
Graphical view of sequence lists
The graphical view of sequence lists is almost identical to the view of single sequences (see
section 10.1). The main difference is that you now can see more than one sequence in the same
view.
However, you also have a few extra options for sorting, deleting and adding sequences:
• To add extra sequences to the list, right-click an empty (white) space in the view, and select
Add Sequences.
• To delete a sequence from the list, right-click the sequence's name and select Delete
Sequence.
• To sort the sequences in the list, right-click the name of one of the sequences and select
Sort Sequence List by Name or Sort Sequence List by Length.
• To rename a sequence, right-click the name of the sequence and select Rename Sequence.
10.7.2
Sequence list table
Each sequence in the table sequence list is displayed with:
CHAPTER 10. VIEWING AND EDITING SEQUENCES
145
Figure 10.16: A sequence list containing multiple sequences can be viewed in either a table or in
a graphical sequence list. The graphical view is useful for viewing annotations and the sequence
itself, while the table view provides other information like sequence lengths, and the number of
sequences in the list (number of Rows reported).
• Name.
• Accession.
• Description.
• Modification date.
• Length.
The number of sequences in the list is reported as the number of Rows at the top of the table
view.
Learn more about tables in section C.
Adding and removing sequences from the list is easy: adding is done by dragging the sequence
from another list or from the Navigation Area and drop it in the table. To delete sequences,
simply select them and press Delete ( ).
You can also create a subset of the sequence list:
select the relevant sequences | right-click | Create New Sequence List
This will create a new sequence list which only includes the selected sequences.
10.7.3
Extract sequences
It is possible to extract individual sequences from a sequence list in two ways. If the sequence
list is opened in the tabular view, it is possible to drag (with the mouse) one or more sequences
CHAPTER 10. VIEWING AND EDITING SEQUENCES
146
into the Navigation Area. This allows you to extract specific sequences from the entire list.
Another option is to extract all sequences found in the list. This can also be done for:
• Alignments (
)
• Contigs and read mappings (
• Read mapping tables (
• BLAST result (
)
)
)
• BLAST overview tables (
• RNA-Seq samples (
)
)
• and of course sequence lists (
)
For mappings and BLAST results, the main sequences (i.e. reference/consensus and query
sequence) will not be extracted.
To extract the sequences:
Toolbox | General Sequence Analyses (
) | Extract Sequences (
)
This will allow you to select the elements that you want to extract sequences from (see the list
above). Clicking Next displays the dialog shown in 10.17.
Figure 10.17: Choosing whether the extracted sequences should be placed in a new list or as
single sequences.
Here you can choose whether the extracted sequences should be placed in a new list or extracted
as single sequences. For sequence lists, only the last option makes sense, but for alignments,
mappings and BLAST results, it would make sense to place the sequences in a list.
CHAPTER 10. VIEWING AND EDITING SEQUENCES
147
Below these options you can see the number of sequences that will be extracted.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
Chapter 11
Online database search
Contents
11.1 GenBank search . . . . . . . . . . . . . . . . .
11.1.1 GenBank search options . . . . . . . . .
11.1.2 Handling of GenBank search results . . .
11.1.3 Save GenBank search parameters . . . .
11.2 UniProt (Swiss-Prot/TrEMBL) search . . . . .
11.2.1 UniProt search options . . . . . . . . . .
11.2.2 Handling of UniProt search results . . . .
11.2.3 Save UniProt search parameters . . . . .
11.3 Search for structures at NCBI . . . . . . . . .
11.3.1 Structure search options . . . . . . . . .
11.3.2 Handling of NCBI structure search results
11.3.3 Save structure search parameters . . . .
11.4 Sequence web info . . . . . . . . . . . . . . .
11.4.1 Google sequence . . . . . . . . . . . . .
11.4.2 NCBI . . . . . . . . . . . . . . . . . . . .
11.4.3 PubMed References . . . . . . . . . . . .
11.4.4 UniProt . . . . . . . . . . . . . . . . . . .
11.4.5 Additional annotation information . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
148
149
150
151
152
152
153
154
154
155
156
157
158
158
158
159
159
159
CLC Protein Workbench offers different ways of searching data on the Internet. You must be
online when initiating and performing the following searches:
11.1
GenBank search
This section describes searches for sequences in GenBank - the NCBI Entrez database.
NCBI search view is opened in this way (figure 11.1):
Search | Search for Sequences at NCBI (
or Ctrl + B (
+ B on Mac)
This opens the following view:
148
)
The
CHAPTER 11. ONLINE DATABASE SEARCH
149
Figure 11.1: The GenBank search view.
11.1.1
GenBank search options
Conducting a search in the NCBI Database from CLC Protein Workbench corresponds to conducting
the search on NCBI's website. When conducting the search from CLC Protein Workbench, the
results are available and ready to work with straight away.
You can choose whether you want to search for nucleotide sequences or protein sequences.
As default, CLC Protein Workbench offers one text field where the search parameters can be
entered. Click Add search parameters to add more parameters to your search.
Note! The search is a "and" search, meaning that when adding search parameters to your
search, you search for both (or all) text strings rather than "any" of the text strings.
You can append a wildcard character by checking the checkbox at the bottom. This means that
you only have to enter the first part of the search text, e.g. searching for "genom" will find both
"genomic" and "genome".
The following parameters can be added to the search:
• All fields. Text, searches in all parameters in the NCBI database at the same time.
• Organism. Text.
• Description. Text.
• Modified Since. Between 30 days and 10 years.
• Gene Location. Genomic DNA/RNA, Mitochondrion, or Chloroplast.
• Molecule. Genomic DNA/RNA, mRNA or rRNA.
• Sequence Length. Number for maximum or minimum length of the sequence.
CHAPTER 11. ONLINE DATABASE SEARCH
150
• Gene Name. Text.
The search parameters are the most recently used. The All fields allows searches in all
parameters in the NCBI database at the same time. All fields also provide an opportunity to restrict a search to parameters which are not listed in the dialog. E.g. writing
gene[Feature key] AND mouse in All fields generates hits in the GenBank database which
contains one or more genes and where 'mouse' appears somewhere in GenBank file. You can
also write e.g. CD9 NOT homo sapiens in All fields.
Note! The 'Feature Key' option is only available in GenBank when searching for nucleotide
sequences. For more information about how to use this syntax, see http://www.ncbi.nlm.
nih.gov/books/NBK3837/
When you are satisfied with the parameters you have entered, click Start search.
Note! When conducting a search, no files are downloaded. Instead, the program produces a list
of links to the files in the NCBI database. This ensures a much faster search.
11.1.2
Handling of GenBank search results
The search result is presented as a list of links to the files in the NCBI database. The View
displays 50 hits at a time. This can be changed in the Preferences (see chapter 5). More hits
can be displayed by clicking the More... button at the bottom right of the View.
Each sequence hit is represented by text in three columns:
• Accession.
• Description.
• Modification date.
• Length.
It is possible to exclude one or more of these columns by adjust the View preferences for the
database search view. Furthermore, your changes in the View preferences can be saved. See
section 5.5.
Several sequences can be selected, and by clicking the buttons in the bottom of the search view,
you can do the following:
• Download and open, doesn't save the sequence.
• Download and save, lets you choose location for saving sequence.
• Open at NCBI, searches the sequence at NCBI's web page.
Double-clicking a hit will download and open the sequence. The hits can also be copied into the
View Area or the Navigation Area from the search results by drag and drop, copy/paste or by
using the right-click menu as described below.
CHAPTER 11. ONLINE DATABASE SEARCH
151
Drag and drop from GenBank search results
The sequences from the search results can be opened by dragging them into a position in the
View Area.
Note! A sequence is not saved until the View displaying the sequence is closed. When that
happens, a dialog opens: Save changes of sequence x? (Yes or No).
The sequence can also be saved by dragging it into the Navigation Area. It is possible to select
more sequences and drag all of them into the Navigation Area at the same time.
Download GenBank search results using right-click menu
You may also select one or more sequences from the list and download using the right-click menu
(see figure 11.2). Choosing Download and Save lets you select a folder where the sequences
are saved when they are downloaded. Choosing Download and Open opens a new view for each
of the selected sequences.
Figure 11.2: By right-clicking a search result, it is possible to choose how to handle the relevant
sequence.
Copy/paste from GenBank search results
When using copy/paste to bring the search results into the Navigation Area, the actual files are
downloaded from GenBank.
To copy/paste files into the Navigation Area:
select one or more of the search results | Ctrl + C (
in the Navigation Area | Ctrl + V
+ C on Mac) | select a folder
Note! Search results are downloaded before they are saved. Downloading and saving several
files may take some time. However, since the process runs in the background (displayed in the
Status bar) it is possible to continue other tasks in the program. Like the search process, the
download process can be stopped. This is done in the Toolbox in the Processes tab.
11.1.3
Save GenBank search parameters
The search view can be saved either using dragging the search tab and and dropping it in the
Navigation Area or by clicking Save ( ). When saving the search, only the parameters are saved
- not the results of the search. This is useful if you have a special search that you perform from
time to time.
CHAPTER 11. ONLINE DATABASE SEARCH
152
Even if you don't save the search, the next time you open the search view, it will remember the
parameters from the last time you did a search.
11.2
UniProt (Swiss-Prot/TrEMBL) search
This section describes searches in UniProt and the handling of search results. UniProt is a global
database of protein sequences.
The UniProt search view (figure 11.3) is opened in this way:
Search | Search for Sequences in UniProt (
)
Figure 11.3: The UniProt search view.
11.2.1
UniProt search options
Conducting a search in UniProt from CLC Protein Workbench corresponds to conducting the
search on UniProt's website. When conducting the search from CLC Protein Workbench, the
results are available and ready to work with straight away.
Above the search fields, you can choose which database to search:
• Swiss-Prot This is believed to be the most accurate and best quality protein database
available. All entries in the database has been currated manually and data are entered
according to the original research paper.
• TrEMBL This database contain computer annotated protein sequences, thus the quality of
the annotations is not as good as the Swiss-Prot database.
As default, CLC Protein Workbench offers one text field where the search parameters can be
entered. Click Add search parameters to add more parameters to your search.
Note! The search is a "and" search, meaning that when adding search parameters to your
search, you search for both (or all) text strings rather than "any" of the text strings.
You can append a wildcard character by checking the checkbox at the bottom. This means that
you only have to enter the first part of the search text, e.g. searching for "genom" will find both
"genomic" and "genome".
CHAPTER 11. ONLINE DATABASE SEARCH
153
The following parameters can be added to the search:
• All fields. Text, searches in all parameters in the UniProt database at the same time.
• Organism. Text.
• Description. Text.
• Created Since. Between 30 days and 10 years.
• Feature. Text.
The search parameters listed in the dialog are the most recently used. The All fields allows
searches in all parameters in the UniProt database at the same time.
When you are satisfied with the parameters you have entered, click Start search.
Note! When conducting a search, no files are downloaded. Instead, the program produces a list
of links to the files in the UniProt database. This ensures a much faster search.
11.2.2
Handling of UniProt search results
The search result is presented as a list of links to the files in the UniProt database. The View
displays 50 hits at a time (can be changed in the Preferences (see chapter 5). More hits can
be displayed by clicking the More... button at the bottom right of the View. More hits can be
displayed by clicking the More... button at the bottom left of the View.
Each sequence hit is represented by text in three columns:
• Accession
• Name
• Description
• Organism
• Length.
It is possible to exclude one or more of these columns by adjust the View preferences for the
database search view. Furthermore, your changes in the View preferences can be saved. See
section 5.5.
Several sequences can be selected, and by clicking the buttons in the bottom of the search view,
you can do the following:
• Download and open, does not save the sequence.
• Download and save, lets you choose location for saving sequence.
• Open at UniProt, searches the sequence at UniProt's web page.
Double-clicking a hit will download and open the sequence. The hits can also be copied into the
View Area or the Navigation Area from the search results by drag and drop, copy/paste or by
using the right-click menu as described below.
CHAPTER 11. ONLINE DATABASE SEARCH
154
Drag and drop from UniProt search results
The sequences from the search results can be opened by dragging them into a position in the
View Area.
Note! A sequence is not saved until the View displaying the sequence is closed. When that
happens, a dialog opens: Save changes of sequence x? (Yes or No).
The sequence can also be saved by dragging it into the Navigation Area. It is possible to select
more sequences and drag all of them into the Navigation Area at the same time.
Download UniProt search results using right-click menu
You may also select one or more sequences from the list and download using the right-click
menu (see figure 11.2). Choosing Download and Save lets you select a folder or location where
the sequences are saved when they are downloaded. Choosing Download and Open opens a
new view for each of the selected sequences.
Copy/paste from UniProt search results
When using copy/paste to bring the search results into the Navigation Area, the actual files are
downloaded from UniProt.
To copy/paste files into the Navigation Area:
select one or more of the search results | Ctrl + C (
or folder in the Navigation Area | Ctrl + V
+ C on Mac) | select location
Note! Search results are downloaded before they are saved. Downloading and saving several
files may take some time. However, since the process runs in the background (displayed in the
Toolbox under the Processes tab) it is possible to continue other tasks in the program. Like the
search process, the download process can be stopped, paused, and resumed.
11.2.3
Save UniProt search parameters
The search view can be saved either using dragging the search tab and and dropping it in the
Navigation Area or by clicking Save ( ). When saving the search, only the parameters are saved
- not the results of the search. This is useful if you have a special search that you perform from
time to time.
Even if you don't save the search, the next time you open the search view, it will remember the
parameters from the last time you did a search.
11.3
Search for structures at NCBI
This section describes searches for three dimensional structures from the NCBI structure
database http://www.ncbi.nlm.nih.gov/Structure/MMDB/mmdb.shtml. For manipulating and visualization of the downloaded structures see section 13.
The NCBI search view is opened in this way:
Search | Search for structures at NCBI (
)
CHAPTER 11. ONLINE DATABASE SEARCH
or Ctrl + B (
155
+ B on Mac)
This opens the view shown in figure 11.4:
Figure 11.4: The structure search view.
11.3.1
Structure search options
Conducting a search in the NCBI Database from CLC Protein Workbench corresponds to conducting
search for structures on the NCBI's Entrez website. When conducting the search from CLC Protein
Workbench, the results are available and ready to work with straight away.
As default, CLC Protein Workbench offers one text field where the search parameters can be
entered. Click Add search parameters to add more parameters to your search.
Note! The search is a "AND" search, meaning that when adding search parameters to your
search, you search for both (or all) text strings rather than "any" of the text strings.
You can append a wildcard character by clicking the checkbox at the bottom. This means that
you only have to enter the first part of the search text, e.g. searching for "prot" will find both
"protein" and "protease".
The following parameters can be added to the search:
• All fields. Text, searches in all parameters in the NCBI structure database at the same
time.
• Organism. Text.
• Author. Text.
• PdbAcc. The accession number of the structure in the PDB database.
CHAPTER 11. ONLINE DATABASE SEARCH
The search parameters are the most recently used.
parameters in the database at the same time.
156
The All fields allows searches in all
All fields also provide an opportunity to restrict a search to parameters which are not
listed in the dialog. E.g. writing 'gene[Feature key] AND mouse' in All fields generates
hits in the GenBank database which contains one or more genes and where 'mouse' appears somewhere in GenBank file. NB: the 'Feature Key' option is only available in GenBank when searching for nucleotide structures. For more information about how to use this
syntax, see http://www.ncbi.nlm.nih.gov/entrez/query/static/help/Summary_
Matrices.html#Search_Fields_and_Qualifiers
When you are satisfied with the parameters you have entered click Start search.
Note! When conducting a search, no files are downloaded. Instead, the program produces a list
of links to the files in the NCBI database. This ensures a much faster search.
11.3.2
Handling of NCBI structure search results
The search result is presented as a list of links to the files in the NCBI database. The View
displays 50 hits at a time (can be changed in the Preferences (see chapter 5). More hits can be
displayed by clicking the More... button at the bottom right of the View.
Each structure hit is represented by text in three columns:
• Accession.
• Description.
• Resolution.
• Method.
• Protein chains
• Release date.
It is possible to exclude one or more of these columns by adjust the View preferences for the
database search view. Furthermore, your changes in the View preferences can be saved. See
section 5.5.
Several structures can be selected, and by clicking the buttons in the bottom of the search view,
you can do the following:
• Download and open. Download and open immediately.
• Download and save. Download and save lets you choose location for saving structure.
• Open at NCBI. Open additional information on the selected structure at NCBI's web page.
Double-clicking a hit will download and open the structure. The hits can also be copied into the
View Area or the Navigation Area from the search results by drag and drop, copy/paste or by
using the right-click menu as described below.
CHAPTER 11. ONLINE DATABASE SEARCH
157
Drag and drop from structure search results
The structures from the search results can be opened by dragging them into a position in the
View Area.
Note! A structure is not saved until the View displaying the structure is closed. When that
happens, a dialog opens: Save changes of structure x? (Yes or No).
The structure can also be saved by dragging it into the Navigation Area. It is possible to select
more structures and drag all of them into the Navigation Area at the same time.
Download structure search results using right-click menu
You may also select one or more structures from the list and download using the right-click menu
(see figure 11.5). Choosing Download and Save lets you select a folder or location where the
structures are saved when they are downloaded. Choosing Download and Open opens a new
view for each of the selected structures.
Figure 11.5: By right-clicking a search result, it is possible to choose how to handle the relevant
structure.
The selected structures are not downloaded from the NCBI website but is downloaded from the
RCSB Protein Data Bank http://www.rcsb.org/pdb/home/home.do in mmCIF format.
Copy/paste from structure search results
When using copy/paste to bring the search results into the Navigation Area, the actual files are
downloaded.
To copy/paste files into the Navigation Area:
select one or more of the search results | Ctrl + C (
or folder in the Navigation Area | Ctrl + V
+ C on Mac) | select location
Note! Search results are downloaded before they are saved. Downloading and saving several
files may take some time. However, since the process runs in the background (displayed in the
Status bar) it is possible to continue other tasks in the program. Like the search process, the
download process can be stopped. This is done in the Toolbox in the Processes tab.
11.3.3
Save structure search parameters
The search view can be saved either using dragging the search tab and and dropping it in the
Navigation Area or by clicking Save ( ). When saving the search, only the parameters are saved
CHAPTER 11. ONLINE DATABASE SEARCH
158
- not the results of the search. This is useful if you have a special search that you perform from
time to time.
Even if you don't save the search, the next time you open the search view, it will remember the
parameters from the last time you did a search.
11.4
Sequence web info
CLC Protein Workbench provides direct access to web-based search in various databases and on
the Internet using your computer's default browser. You can look up a sequence in the databases
of NCBI and UniProt, search for a sequence on the Internet using Google and search for Pubmed
references at NCBI. This is useful for quickly obtaining updated and additional information about
a sequence.
The functionality of these search functions depends on the information that the sequence
contains. You can see this information by viewing the sequence as text (see section 10.5). In
the following sections, we will explain this in further detail.
The procedure for searching is identical for all four search options (see also figure 11.6):
Open a sequence or a sequence list | Right-click the name of the sequence | Web
Info ( ) | select the desired search function
Figure 11.6: Open webpages with information about this sequence.
This will open your computer's default browser searching for the sequence that you selected.
11.4.1
Google sequence
The Google search function uses the accession number of the sequence which is used as
search term on http://www.google.com. The resulting web page is equivalent to typing the
accession number of the sequence into the search field on http://www.google.com.
11.4.2
NCBI
The NCBI search function searches in GenBank at NCBI (http://www.ncbi.nlm.nih.gov)
using an identification number (when you view the sequence as text it is the "GI" number).
Therefore, the sequence file must contain this number in order to look it up at NCBI. All
sequences downloaded from NCBI have this number.
CHAPTER 11. ONLINE DATABASE SEARCH
11.4.3
159
PubMed References
The PubMed references search option lets you look up Pubmed articles based on references
contained in the sequence file (when you view the sequence as text it contains a number of
"PUBMED" lines). Not all sequence have these PubMed references, but in this case you will se
a dialog and the browser will not open.
11.4.4
UniProt
The UniProt search function searches in the UniProt database (http://www.ebi.uniprot.
org) using the accession number. Furthermore, it checks whether the sequence was indeed
downloaded from UniProt.
11.4.5
Additional annotation information
When sequences are downloaded from GenBank they often link to additional information on
taxonomy, conserved domains etc. If such information is available for a sequence it is possible
to access additional accurate online information. If the db_xref identifier line is found as part
of the annotation information in the downloaded GenBank file, it is possible to easily look up
additional information on the NCBI web-site.
To access this feature, simply right click an annotation and see which databases are available.
Chapter 12
BLAST Search
Contents
12.1 Running BLAST searches . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 161
12.1.1
BLAST at NCBI . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 162
12.1.2
BLAST a partial sequence against NCBI . . . . . . . . . . . . . . . . . . 165
12.1.3
BLAST against local data . . . . . . . . . . . . . . . . . . . . . . . . . . 165
12.1.4 BLAST a partial sequence against a local database . . . . . . . . . . . . 167
12.2 Output from BLAST searches . . . . . . . . . . . . . . . . . . . . . . . . . . . 167
12.2.1
Graphical overview for each query sequence . . . . . . . . . . . . . . . . 167
12.2.2
Overview BLAST table . . . . . . . . . . . . . . . . . . . . . . . . . . . . 167
12.2.3
BLAST graphics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 169
12.2.4
BLAST table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 170
12.3 Local BLAST databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 172
12.3.1
Make pre-formatted BLAST databases available . . . . . . . . . . . . . . 173
12.3.2
Download NCBI pre-formatted BLAST databases . . . . . . . . . . . . . . 173
12.3.3
Create local BLAST databases . . . . . . . . . . . . . . . . . . . . . . . 174
12.4 Manage BLAST databases . . . . . . . . . . . . . . . . . . . . . . . . . . . . 175
12.4.1
Migrating from a previous version of the Workbench . . . . . . . . . . . . 176
12.5 Bioinformatics explained: BLAST . . . . . . . . . . . . . . . . . . . . . . . . . 176
12.5.1
Examples of BLAST usage . . . . . . . . . . . . . . . . . . . . . . . . . . 177
12.5.2
Searching for homology . . . . . . . . . . . . . . . . . . . . . . . . . . . 177
12.5.3
How does BLAST work? . . . . . . . . . . . . . . . . . . . . . . . . . . . 177
12.5.4
Which BLAST program should I use? . . . . . . . . . . . . . . . . . . . . 179
12.5.5
Which BLAST options should I change?
12.5.6
Explanation of the BLAST output . . . . . . . . . . . . . . . . . . . . . . 181
12.5.7
I want to BLAST against my own sequence database, is this possible? . 183
12.5.8
What you cannot get out of BLAST . . . . . . . . . . . . . . . . . . . . . 184
12.5.9
Other useful resources . . . . . . . . . . . . . . . . . . . . . . . . . . . 184
. . . . . . . . . . . . . . . . . . 180
CLC Protein Workbench offers to conduct BLAST searches on protein and DNA sequences.
In short, a BLAST search identifies homologous sequences between your input (query) query
sequence and a database of sequences [McGinnis and Madden, 2004]. BLAST (Basic Local
160
CHAPTER 12. BLAST SEARCH
161
Alignment Search Tool), identifies homologous sequences using a heuristic method which finds
short matches between two sequences. After initial match BLAST attempts to start local
alignments from these initial matches.
If you are interested in the bioinformatics behind BLAST, there is an easy-to-read explanation of
this in section 12.5.
With CLC Protein Workbench there are two ways of performing BLAST searches: You can either
have the BLAST process run on NCBI's BLAST servers (http://www.ncbi.nlm.nih.gov/)
or perform the BLAST search on your own computer. The advantage of running the BLAST search
on NCBI servers is that you have readily access to the most popular BLAST databases without
having to download them to your own computer. The advantage of running BLAST on your own
computer is that you can use your own sequence data, and that this can sometimes be faster
and more reliable for big batch BLAST jobs
Figure 12.8 shows an example of a BLAST result in the CLC Protein Workbench.
Figure 12.1: Display of the output of a BLAST search. At the top is there a graphical representation
of BLAST hits with tool-tips showing additional information on individual hits. Below is a tabular
form of the BLAST results.
12.1
Running BLAST searches
With the CLC Protein Workbench there are two ways of performing BLAST searches: You can either
have the BLAST process run on NCBI's BLAST servers (http://www.ncbi.nlm.nih.gov/)
or you can perform the BLAST search on your own computer.
The advantage of running the BLAST search on NCBI servers is that you have readily access to
the popular, and often very large, BLAST databases without having to download them to your
own computer. The advantages of running BLAST on your own computer include that you can use
your own sequence collections as blast databases, and that running big batch BLAST jobs can
be faster and more reliable when done locally.
CHAPTER 12. BLAST SEARCH
12.1.1
162
BLAST at NCBI
When running a BLAST search at the NCBI, the Workbench sends the sequences you select to
the NCBI's BLAST servers. When the results are ready, they will be automatically downloaded
and displayed in the Workbench. When you enter a large number of sequences for searching with
BLAST, the Workbench automatically splits the sequences up into smaller subsets and sends
one subset at the time to NCBI. This is to avoid exceeding any internal limits the NCBI places on
the number of sequences that can be submitted to them for BLAST searching. The size of the
subset created in the CLC software depends both on the number and size of the sequences.
To start a BLAST job to search your sequences against databases held at the NCBI:
Toolbox | BLAST (
) | NCBI BLAST (
)
Alternatively, use the keyboard shortcut: Ctrl+Shift+B for Windows and
+Shift+B on Mac OS.
This opens the dialog seen in figure 12.2
Figure 12.2: Choose one or more sequences to conduct a BLAST search with.
Select one or more sequences of the same type (either DNA or protein) and click Next.
In this dialog, you choose which type of BLAST search to conduct, and which database to search
against. See figure 12.3. The databases at the NCBI listed in the dropdown box will correspond
to the query sequence type you have, DNA or protein, and the type of blast search you have
chosen to run. A complete list of these databases can be found in Appendix D. Here you can also
read how to add additional databases available the NCBI to the list provided in the dropdown
menu.
Figure 12.3: Choose a BLAST Program and a database for the search.
BLAST programs for DNA query sequences:
CHAPTER 12. BLAST SEARCH
163
• BLASTn: DNA sequence against a DNA database. Used to look for DNA sequences with
homologous regions to your nucleotide query sequence.
• BLASTx: Translated DNA sequence against a Protein database. Automatic translation
of your DNA query sequence in six frames; these translated sequences are then used to
search a protein database.
• tBLASTx: Translated DNA sequence against a Translated DNA database. Automatic
translation of your DNA query sequence and the DNA database, in six frames. The resulting
peptide query sequences are used to search the resulting peptide database. Note that this
type of search is computationally intensive.
BLAST programs for protein query sequences:
• BLASTp: Protein sequence against Protein database. Used to look for peptide sequences
with homologous regions to your peptide query sequence.
• tBLASTn: Protein sequence against Translated DNA database. Peptide query sequences
are searched against an automatically translated, in six frames, DNA database.
If you search against the Protein Data Bank protein database homologous sequences are found
to the query sequence, these can be downloaded and opened with the 3D view.
Click Next.
This window, see figure 12.4, allows you to choose parameters to tune your BLAST search, to
meet your requirements.
Figure 12.4: Parameters that can be set before submitting a BLAST search.
When choosing BLASTx or tBLASTx to conduct a search, you get the option of selecting a
translation table for the genetic code. The standard genetic code is set as default. This setting is
particularly useful when working with organisms or organelles that have a genetic code different
from the standard genetic code.
The following description of BLAST search parameters is based on information from http:
//www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml.
• Limit by Entrez query BLAST searches can be limited to the results of an Entrez query against
the database chosen. This can be used to limit searches to subsets of entries in the BLAST
databases. Any terms can be entered that would normally be allowed in an Entrez search
CHAPTER 12. BLAST SEARCH
164
session. More information about Entrez queries can be found at http://www.ncbi.
nlm.nih.gov/books/NBK3837/#EntrezHelp.Entrez_Searching_Options. The
syntax described there is the same as would be accepted in the CLC interface. Some
commonly used Entrez queries are pre-entered and can be chosen in the drop down menu.
• Choose filter
Low-complexity. Mask off segments of the query sequence that have low compositional complexity. Filtering can eliminate statistically significant, but biologically
uninteresting reports from the BLAST output (e.g. hits against common acidic-, basicor proline-rich regions), leaving the more biologically interesting regions of the query
sequence available for specific matching against database sequences.
Mask lower case. If you have a sequence with regions denoted in lower case, and
other regions in upper case, then choosing this option would keep any of the regions
in lower case from being considered in your BLAST search.
• Expect. The threshold for reporting matches against database sequences: the default
value is 10, meaning that under the circumstances of this search, 10 matches are expected
to be found merely by chance according to the stochastic model of Karlin and Altschul
(1990). Details of how E-values are calculated can be found at the NCBI: http://www.
ncbi.nlm.nih.gov/BLAST/tutorial/Altschul-1.html If the E-value ascribed to
a match is greater than the EXPECT threshold, the match will not be reported. Lower EXPECT
thresholds are more stringent, leading to fewer chance matches being reported. Increasing
the threshold results in more matches being reported, but many may just matching by
chance, not due to any biological similarity. Values of E less than one can be entered as
decimals, or in scientific notiation. For example, 0.001, 1e-3 and 10e-4 would be equivalent
and acceptable values.
• Word Size. BLAST is a heuristic that works by finding word-matches between the query
and database sequences. You may think of this process as finding "hot-spots" that BLAST
can then use to initiate extensions that might lead to full-blown alignments. For nucleotidenucleotide searches (i.e. "BLASTn") an exact match of the entire word is required before
an extension is initiated, so that you normally regulate the sensitivity and speed of the
search by increasing or decreasing the wordsize. For other BLAST searches non-exact word
matches are taken into account based upon the similarity between words. The amount of
similarity can be varied so that you normally uses just the wordsizes 2 and 3 for these
searches.
• Matrix. A key element in evaluating the quality of a pairwise sequence alignment is the
"substitution matrix", which assigns a score for aligning any possible pair of residues. The
matrix used in a BLAST search can be changed depending on the type of sequences you
are searching with (see the BLAST Frequently Asked Questions). Only applicable for protein
sequences or translated DNA sequences.
• Gap Cost. The pull down menu shows the Gap Costs (Penalty to open Gap and penalty to
extend Gap). Increasing the Gap Costs and Lambda ratio will result in alignments which
decrease the number of Gaps introduced.
• Max number of hit sequences. The maximum number of database sequences, where
BLAST found matches to your query sequence, to be included in the BLAST report.
CHAPTER 12. BLAST SEARCH
165
The parameters you choose will affect how long BLAST takes to run. A search of a small database,
requesting only hits that meet stringent criteria will generally be quite quick. Searching large
databases, or allowing for very remote matches, will of course take longer.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
12.1.2
BLAST a partial sequence against NCBI
You can search a database using only a part of a sequence directly from the sequence view:
select the sequence region to send to BLAST | right-click the selection | BLAST
Selection Against NCBI ( )
This will go directly to the dialog shown in figure 12.3 and the rest of the options are the same
as when performing a BLAST search with a full sequence.
12.1.3
BLAST against local data
Running BLAST searches on your local machine can have several advantages over running the
searches remotely at the NCBI:
• It can be faster.
• It does not rely on having a stable internet connection.
• It does not depend on the availability of the NCBI BLAST blast servers.
• You can use longer query sequences.
• You use your own data sets to search against.
On a technical level, the CLC Protein Workbench uses the NCBI's blast+ software (see ftp:
//ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/). Thus, the results
of using a particular data set to search the same database, with the same search parameters,
would give the same results, whether run locally or at the NCBI.
There are a number of options for what you can search against:
• You create a database based on data already imported into your Workbench (see section 12.3.3)
• You can add pre-formatted databases (see section 12.3.1)
• You can use sequence data from the Navigation Area directly, without creating a database
first.
To conduct a BLAST search:
or Toolbox | BLAST (
) | Local BLAST (
)
This opens the dialog seen in figure 12.5:
Select one or more sequences of the same type (DNA or protein) and click Next.
CHAPTER 12. BLAST SEARCH
166
Figure 12.5: Choose one or more sequences to conduct a BLAST search.
Figure 12.6: Choose a BLAST program and a target database.
This opens the dialog seen in figure 12.6:
At the top, you can choose between different BLAST programs. See section 12.1.1 for information
about these methods.
You then specify the target database to use:
• Sequences. When you choose this option, you can use sequence data from the Navigation
Area as database by clicking the Browse and select icon ( ). A temporary BLAST
database will be created from these sequences and used for the BLAST search. It is
deleted afterwards. If you want to be able to click in the BLAST result to retrieve the hit
sequences from the BLAST database at a later point, you should not use this option; create
a create a BLAST database first, see section 12.3.3.
• BLAST Database. Select a database already available in one of your designated BLAST
database folders. Read more in section 12.4.
When a database or a set of sequences has been selected, click Next.
This opens the dialog seen in figure 12.7:
See section 12.1.1 for information about these limitations.
There is one setting available for local BLAST jobs that is not relevant for remote searches at the
NCBI:
• Number of processors. You can specify the number of processors which should be used if
your Workbench is installed on a multi-processor system.
CHAPTER 12. BLAST SEARCH
167
Figure 12.7: Examples of parameters that can be set before submitting a BLAST search.
12.1.4
BLAST a partial sequence against a local database
You can search a database using only a part of a sequence directly from the sequence view:
select the region that you wish to BLAST | right-click the selection | BLAST
Selection Against Local Database ( )
This will go directly to the dialog shown in figure 12.6 and the rest of the options are the same
as when performing a BLAST search with a full sequence.
12.2
Output from BLAST searches
The output of a BLAST search is similar whether you have chosen to run your search locally or at
the NCBI. If a single query sequence was used, then the results will show the hits found in that
database with that single sequence. If more than one sequence was used to query a database,
the default view of the results is a summary table, showing the description of the top database
hit against each query sequence, and the number of hits found.
12.2.1
Graphical overview for each query sequence
Double clicking on a given row of a tabular blast table opens a graphical overview of the blast
results for a particular query sequence, as shown in figure figure 12.8. In cases where only one
sequence was entered into a BLAST search, such a graphical overview is the default output.
Figure 12.8 shows an example of a BLAST result for an individual query sequence in the CLC
Protein Workbench.
Detailed descriptions of the overview BLAST table and the graphical BLAST results view are
described below.
12.2.2
Overview BLAST table
In the overview BLAST table for a multi-sequence blast search, as shown in figure 12.9, there is
one row for each query sequence. Each row represents the BLAST result for this query sequence.
Double-clicking a row will open the BLAST result for this query sequence, allowing more detailed
investigation of the result. You can also select one or more rows and click the Open BLAST
Output button at the bottom of the view. Clicking the Open Query Sequence will open a sequence
CHAPTER 12. BLAST SEARCH
168
Figure 12.8: Default display of the output of a BLAST search for one query sequence. At the top
is there a graphical representation of BLAST hits with tool-tips showing additional information on
individual hits.
Figure 12.9: An overview BLAST table summarizing the results for a number of query sequences.
list with the selected query sequences. This can be useful in work flows where BLAST is used as
a filtering mechanism where you can filter the table to include e.g. sequences that have a certain
top hit and then extract those.
In the overview table, the following information is shown:
• Query: Since this table displays information about several query sequences, the first column
is the name of the query sequence.
• Number of hits: The number of hits for this query sequence.
• For the following list, the value of the best hit is displayed together with accession number
CHAPTER 12. BLAST SEARCH
169
and description of this hit.
Lowest E-value
Greatest identity %
Greatest positive %
Greatest hit length
Greatest bit score
If you wish to save some of the BLAST results as individual elements in the Navigation Area,
open them and click Save As in the File menu.
12.2.3
BLAST graphics
The BLAST editor shows the sequences hits which were found in the BLAST search. The hit
sequences are represented by colored horizontal lines, and when hovering the mouse pointer
over a BLAST hit sequence, a tooltip appears, listing the characteristics of the sequence. As
default, the query sequence is fitted to the window width, but it is possible to zoom in the
windows and see the actual sequence alignments returned from the BLAST server.
There are several settings available in the BLAST Graphics view.
• BLAST Layout. You can choose to Gather sequences at top. Enabling this option affects
the view that is shown when scrolling horizontally along a BLAST result. If selected, the
sequence hits which did not contribute to the visible part of the BLAST graphics will be
omitted whereas the found BLAST hits will automatically be placed right below the query
sequence.
• Compactness: You can control the level of sequence detail to be displayed:
Not compact. Full detail and spaces between the sequences.
Low. The normal settings where the residues are visible (when zoomed in) but with no
extra spaces between.
Medium. The sequences are represented as lines and the residues are not visible.
There is some space between the sequences.
Compact. Even less space between the sequences.
• BLAST hit coloring. You can choose whether to color hit sequences and you can adjust the
coloring.
• Coverage: In the Alignment info in the Side Panel, you can visualize the number of hit
sequences at a given position on the query sequence. The level of coverage is relative to
the overall number of hits included in the result.
Foreground color. Colors the letters using a gradient, where the left side color is used
for low coverage and the right side is used for maximum coverage.
Background color. Colors the background of the letters using a gradient, where the left
side color is used for low coverage and the right side is used for maximum coverage
Graph. The coverage is displayed as a graph beneath the query sequence (Learn how
to export the data behind the graph in section 7.4).
CHAPTER 12. BLAST SEARCH
170
∗ Height. Specifies the height of the graph.
∗ Type. The graph can be displayed as Line plot, Bar plot or as a Color bar.
∗ Color box. For Line and Bar plots, the color of the plot can be set by clicking the
color box. If a Color bar is chosen, the color box is replaced by a gradient color
box as described under Foreground color.
The remaining View preferences for BLAST Graphics are the same as those of alignments. See
section 18.2.
Some of the information available in the tooltips is:
• Name of sequence. Here is shown some additional information of the sequence which
was found. This line corresponds to the description line in GenBank (if the search was
conducted on the nr database).
• Score. This shows the bit score of the local alignment generated through the BLAST search.
• Expect. Also known as the E-value. A low value indicates a homologous sequence. Higher
E-values indicate that BLAST found a less homologous sequence.
• Identities. This number shows the number of identical residues or nucleotides in the
obtained alignment.
• Gaps. This number shows whether the alignment has gaps or not.
• Strand. This is only valid for nucleotide sequences and show the direction of the aligned
strands. Minus indicate a complementary strand.
• Query. This is the sequence (or part of the sequence) which you have used for the BLAST
search.
• Sbjct (subject). This is the sequence found in the database.
The numbers of the query and subject sequences refer to the sequence positions in the submitted
and found sequences. If the subject sequence has number 59 in front of the sequence, this
means that 58 residues are found upstream of this position, but these are not included in the
alignment.
By right clicking the sequence name in the Graphical BLAST output it is possible to download the
full hits sequence from NCBI with accompanying annotations and information. It is also possible
to just open the actual hit sequence in a new view.
12.2.4
BLAST table
In addition to the graphical display of a BLAST result, it is possible to view the BLAST results in
a tabular view. In the tabular view, one can get a quick and fast overview of the results. Here
you can also select multiple sequences and download or open all of these in one single step.
Moreover, there is a link from each sequence to the sequence at NCBI. These possibilities are
either available through a right-click with the mouse or by using the buttons below the table.
If the BLAST table view was not selected in Step 4 of the BLAST search, the table can be shown
in the following way:
CHAPTER 12. BLAST SEARCH
Click the Show BLAST Table button (
171
) at the bottom of the view
Figure 12.10 is an example of a BLAST Table.
Figure 12.10: Display of the output of a BLAST search in the tabular view. The hits can be sorted
by the different columns, simply by clicking the column heading.
The BLAST Table includes the following information:
• Query sequence. The sequence which was used for the search.
• Hit. The Name of the sequences found in the BLAST search.
• Id. GenBank ID.
• Description. Text from NCBI describing the sequence.
• E-value. Measure of quality of the match. Higher E-values indicate that BLAST found a less
homologous sequence.
• Score. This shows the score of the local alignment generated through the BLAST search.
• Bit score. This shows the bit score of the local alignment generated through the BLAST
search. Bit scores are normalized, which means that the bit scores from different alignments
can be compared, even if different scoring matrices have been used.
• Hit start. Shows the start position in the hit sequence
• Hit end. Shows the end position in the hit sequence.
• Hit length. The length of the hit.
• Query start. Shows the start position in the query sequence.
• Query end. Shows the end position in the query sequence.
• Overlap. Display a percentage value for the overlap of the query sequence and hit sequence.
Only the length of the local alignment is taken into account and not the full length query
sequence.
• Identity. Shows the number of identical residues in the query and hit sequence.
• %Identity. Shows the percentage of identical residues in the query and hit sequence.
CHAPTER 12. BLAST SEARCH
172
• Positive. Shows the number of similar but not necessarily identical residues in the query
and hit sequence.
• %Positive. Shows the percentage of similar but not necessarily identical residues in the
query and hit sequence.
• Gaps. Shows the number of gaps in the query and hit sequence.
• %Gaps. Shows the percentage of gaps in the query and hit sequence.
• Query Frame/Strand. Shows the frame or strand of the query sequence.
• Hit Frame/Strand. Shows the frame or strand of the hit sequence.
In the BLAST table view you can handle the hit sequences. Select one or more sequences from
the table, and apply one of the following functions.
• Download and Open. Download the full sequence from NCBI and opens it. If multiple
sequences are selected, they will all open (if the same sequence is listed several times,
only one copy of the sequence is downloaded and opened).
• Download and Save. Download the full sequence from NCBI and save it. When you click
the button, there will be a save dialog letting you specify a folder to save the sequences. If
multiple sequences are selected, they will all open (if the same sequence is listed several
times, only one copy of the sequence is downloaded and opened).
• Open at NCBI. Opens the corresponding sequence(s) at GenBank at NCBI. Here is stored
additional information regarding the selected sequence(s). The default Internet browser is
used for this purpose.
• Open structure. If the hit sequence contain structure information, the sequence is opened
in a text view or a 3D view (3D view in CLC Protein Workbench and CLC Main Workbench).
You can do a text-based search in the information in the BLAST table by using the filter at the
upper right part of the view. In this way you can search for e.g. species or other information which
is typically included in the "Description" field.
The table is integrated with the graphical view described in section 12.2.3 so that selecting a hit
in the table will make a selection on the corresponding sequence in the graphical view.
12.3
Local BLAST databases
BLAST databases on your local system can be made available for searches via your CLC Protein
Workbench, (section 12.3.1). To make adding databases even easier, you can download preformatted BLAST databases from the NCBI from within your CLC Protein Workbench, (section
12.3.2). You can also easily create your own local blast databases from sequences within your
CLC Protein Workbench, (section 12.3.3).
CHAPTER 12. BLAST SEARCH
12.3.1
173
Make pre-formatted BLAST databases available
To use databases that have been downloaded or created outside the Workbench, you can either
• Put the database files in one of the locations defined in the BLAST database manager (see
section 12.4)
• Add the location where your BLAST databases are stored using the BLAST database
manager (see section 12.4). See figure 12.14.
12.3.2
Download NCBI pre-formatted BLAST databases
Many popular pre-formatted databases are available for download from the NCBI. You can
download any of the databases available from the list at ftp://ftp.ncbi.nih.gov/blast/
db/ from within your CLC Protein Workbench.
You must be connected to the internet to use this tool.
If you choose:
or Toolbox | BLAST (
) | Download BLAST Databases (
)
a window like the one in figure 12.11 pops up showing you the list of databases available for
download.
Figure 12.11: Choose from pre-formatted BLAST databases at the NCBI available for download.
In this window, you can see the names of the databases, the date they were made available
for download on the NCBI site, the size of the files associated with that database, and a brief
description of each database. You can also see whether the database has any dependencies.
This aspect is described below.
You can also specify which of your database locations you would like to store the files in. Please
see the Manage BLAST Databases section for more on this (section 12.4).
There are two very important things to note if you wish to take advantage of this tool.
• Many of the databases listed are very large. Please make sure you have room for them.
If you are working on a shared system, we recommend you discuss your plans with your
system administrator and fellow users.
• Some of the databases listed are dependent on others. This will be listed in the
Dependencies column of the Download BLAST Databases window. This means that while
CHAPTER 12. BLAST SEARCH
174
the database your are interested in may seem very small, it may require that you also
download a very big database on which it depends.
An example of the second item above is Swissprot. To download a database from the NCBI that
would allow you to search just Swissprot entries, you need to download the whole nr database
in addition to the entry for Swissprot.
12.3.3
Create local BLAST databases
In the CLC Protein Workbench you can create a local database that you can use for local BLAST
searches. You can specify a location on your computer to save the BLAST database files to. The
Workbench will list the BLAST databases found in these locations when you set up a local BLAST
search (see section 12.1.3).
DNA, RNA, and protein sequences located in the Navigation Area can be used to create BLAST
databases from. Any given BLAST database can only include one molecule type. If you wish to
use a pre-formatted BLAST database instead, see section 12.3.1.
To create a BLAST database, go to:
Toolbox | BLAST (
) | Create BLAST Database (
)
This opens the dialog seen in figure 12.12.
Figure 12.12: Add sequences for the BLAST database.
Select sequences or sequence lists you wish to include in your database and click Next.
In the next dialog, shown in figure 12.13, you provide the following information:
• Name. The name of the BLAST database. This name will be used when running BLAST
searches and also as the base file name for the BLAST database files.
• Description. You can add more details to describe the contents of the database.
• Location. You can select the location to save the BLAST database files to. You can add
or change the locations in this list using the Manage BLAST Databases tool, see section
12.4.
CHAPTER 12. BLAST SEARCH
175
Figure 12.13: Providing a name and description for the database, and the location to save the files
to.
Click Finish to create the BLAST database. Once the process is complete, the new database will
be available in the Manage BLAST Databases dialog, see section 12.4, and when running local
BLAST (see section 12.1.3).
12.4
Manage BLAST databases
The BLAST database available as targets for running local BLAST searches (see section 12.1.3)
can be managed through the Manage BLAST Databases dialog (see figure 12.14):
Toolbox | BLAST (
) | Manage BLAST Databases (
)
Figure 12.14: Overview of available BLAST databases.
At the top of the dialog, there is a list of the BLAST database locations. These locations are
folders where the Workbench will look for valid BLAST databases. These can either be created
from within the Workbench using the Create BLAST Database tool, see section 12.3.3, or they
can be pre-formatted BLAST databases.
The list of locations can be modified using the Add Location and Remove Location buttons.
Once the Workbench has scanned the locations, it will keep a cache of the databases (in order
CHAPTER 12. BLAST SEARCH
176
to improve performance). If you have added new databases that are not listed, you can press
Refresh Locations to clear the cache and search the database locations again.
By default a BLAST database location will be added under your home area in a folder called
CLCdatabases. This folder is scanned recursively, through all subfolders, to look for valid
databases. All other folderlocations are scanned only at the top level.
Below the list of locations, all the BLAST databases are listed with the following information:
• Name. The name of the BLAST database.
• Description. Detailed description of the contents of the database.
• Date. The date the database was created.
• Sequences. The number of sequences in the database.
• Type. The type can be either nucleotide (DNA) or protein.
• Total size (1000 residues). The number of residues in the database, either bases or amino
acid.
• Location. The location of the database.
Below the list of BLAST databases, there is a button to Remove Database. This option will delete
the database files belonging to the database selected.
12.4.1
Migrating from a previous version of the Workbench
In versions released before 2011, the BLAST database management was very different from this.
In order to migrate from the older versions, please add the folders of the old BLAST databases
as locations in the BLAST database manager (see section 12.4). The old representations of the
BLAST databases in the Navigation Area can be deleted.
If you have saved the BLAST databases in the default folder, they will automatically appear
because the default database location used in CLC Protein Workbench 5.8 is the same as the
default folder specified for saving BLAST databases in the old version.
12.5
Bioinformatics explained: BLAST
BLAST (Basic Local Alignment Search Tool) has become the defacto standard in search and
alignment tools [Altschul et al., 1990]. The BLAST algorithm is still actively being developed
and is one of the most cited papers ever written in this field of biology. Many researchers
use BLAST as an initial screening of their sequence data from the laboratory and to get an
idea of what they are working on. BLAST is far from being basic as the name indicates; it
is a highly advanced algorithm which has become very popular due to availability, speed, and
accuracy. In short, a BLAST search identifies homologous sequences by searching one or
more databases usually hosted by NCBI (http://www.ncbi.nlm.nih.gov/), on the query
sequence of interest [McGinnis and Madden, 2004].
BLAST is an open source program and anyone can download and change the program code. This
has also given rise to a number of BLAST derivatives; WU-BLAST is probably the most commonly
used [Altschul and Gish, 1996].
CHAPTER 12. BLAST SEARCH
177
BLAST is highly scalable and comes in a number of different computer platform configurations
which makes usage on both small desktop computers and large computer clusters possible.
12.5.1
Examples of BLAST usage
BLAST can be used for a lot of different purposes. A few of them are mentioned below.
• Looking for species. If you are sequencing DNA from unknown species, BLAST may help
identify the correct species or homologous species.
• Looking for domains. If you BLAST a protein sequence (or a translated nucleotide sequence)
BLAST will look for known domains in the query sequence.
• Looking at phylogeny. You can use the BLAST web pages to generate a phylogenetic tree
of the BLAST result.
• Mapping DNA to a known chromosome. If you are sequencing a gene from a known
species but have no idea of the chromosome location, BLAST can help you. BLAST will
show you the position of the query sequence in relation to the hit sequences.
• Annotations. BLAST can also be used to map annotations from one organism to another
or look for common genes in two related species.
12.5.2
Searching for homology
Most research projects involving sequencing of either DNA or protein have a requirement for
obtaining biological information of the newly sequenced and maybe unknown sequence. If
the researchers have no prior information of the sequence and biological content, valuable
information can often be obtained using BLAST. The BLAST algorithm will search for homologous
sequences in predefined and annotated databases of the users choice.
In an easy and fast way the researcher can gain knowledge of gene or protein function and find
evolutionary relations between the newly sequenced DNA and well established data.
After the BLAST search the user will receive a report specifying found homologous sequences
and their local alignments to the query sequence.
12.5.3
How does BLAST work?
BLAST identifies homologous sequences using a heuristic method which initially finds short
matches between two sequences; thus, the method does not take the entire sequence space
into account. After initial match, BLAST attempts to start local alignments from these initial
matches. This also means that BLAST does not guarantee the optimal alignment, thus some
sequence hits may be missed. In order to find optimal alignments, the Smith-Waterman algorithm
should be used (see below). In the following, the BLAST algorithm is described in more detail.
Seeding
When finding a match between a query sequence and a hit sequence, the starting point is the
words that the two sequences have in common. A word is simply defined as a number of letters.
CHAPTER 12. BLAST SEARCH
178
For blastp the default word size is 3 W=3. If a query sequence has a QWRTG, the searched words
are QWR, WRT, RTG. See figure 12.15 for an illustration of words in a protein sequence.
Figure 12.15: Generation of exact BLAST words with a word size of W=3.
During the initial BLAST seeding, the algorithm finds all common words between the query
sequence and the hit sequence(s). Only regions with a word hit will be used to build on an
alignment.
BLAST will start out by making words for the entire query sequence (see figure 12.15). For each
word in the query sequence, a compilation of neighborhood words, which exceed the threshold
of T, is also generated.
A neighborhood word is a word obtaining a score of at least T when comparing, using a selected
scoring matrix (see figure 12.16). The default scoring matrix for blastp is BLOSUM62 (for
explanation of scoring matrices, see www.clcbio.com/be). The compilation of exact words
and neighborhood words is then used to match against the database sequences.
Figure 12.16: Neighborhood BLAST words based on the BLOSUM62 matrix. Only words where the
threshold T exceeds 13 are included in the initial seeding.
After initial finding of words (seeding), the BLAST algorithm will extend the (only 3 residues
long) alignment in both directions (see figure 12.17). Each time the alignment is extended, an
alignment score is increases/decreased. When the alignment score drops below a predefined
threshold, the extension of the alignment stops. This ensures that the alignment is not extended
to regions where only very poor alignment between the query and hit sequence is possible. If
the obtained alignment receives a score above a certain threshold, it will be included in the final
BLAST result.
By tweaking the word size W and the neighborhood word threshold T, it is possible to limit the
search space. E.g. by increasing T, the number of neighboring words will drop and thus limit the
search space as shown in figure 12.18.
This will increase the speed of BLAST significantly but may result in loss of sensitivity. Increasing
the word size W will also increase the speed but again with a loss of sensitivity.
CHAPTER 12. BLAST SEARCH
179
Figure 12.17: Blast aligning in both directions. The initial word match is marked green.
Figure 12.18: Each dot represents a word match. Increasing the threshold of T limits the search
space significantly.
12.5.4
Which BLAST program should I use?
Depending on the nature of the sequence it is possible to use different BLAST programs for the
database search. There are five versions of the BLAST program, blastn, blastp, blastx, tblastn,
tblastx:
Option
blastn
blastp
tblastn
Query Type
Nucleotide
Protein
Protein
DB Type
Nucleotide
Protein
Nucleotide
Comparison
Nucleotide-Nucleotide
Protein-Protein
Protein-Protein
blastx
Nucleotide
Protein
Protein-Protein
Nucleotide
Protein-Protein
tblastx Nucleotide
Note
The database is translated
into protein
The queries are translated
into protein
The queries and database are
translated into protein
The most commonly used method is to BLAST a nucleotide sequence against a nucleotide
database (blastn) or a protein sequence against a protein database (blastp). But often another
BLAST program will produce more interesting hits. E.g. if a nucleotide sequence is translated
CHAPTER 12. BLAST SEARCH
180
before the search, it is more likely to find better and more accurate hits than just a blastn search.
One of the reasons for this is that protein sequences are evolutionarily more conserved than
nucleotide sequences. Another good reason for translating the query sequence before the search
is that you get protein hits which are likely to be annotated. Thus you can directly see the protein
function of the sequenced gene.
12.5.5
Which BLAST options should I change?
The NCBI BLAST web pages and the BLAST command line tool offer a number of different options
which can be changed in order to obtain the best possible result. Changing these parameters
can have a great impact on the search result. It is not the scope of this document to comment
on all of the options available but merely the options which can be changed with a direct impact
on the search result.
The E-value
The expect value(E-value) can be changed in order to limit the number of hits to the most
significant ones. The lower the E-value, the better the hit. The E-value is dependent on the length
of the query sequence and the size of the database. For example, an alignment obtaining an
E-value of 0.05 means that there is a 5 in 100 chance of occurring by chance alone.
E-values are very dependent on the query sequence length and the database size. Short identical
sequence may have a high E-value and may be regarded as "false positive" hits. This is often
seen if one searches for short primer regions, small domain regions etc. The default threshold
for the E-value on the BLAST web page is 10. Increasing this value will most likely generate more
hits. Below are some rules of thumb which can be used as a guide but should be considered
with common sense.
• E-value < 10e-100 Identical sequences. You will get long alignments across the entire
query and hit sequence.
• 10e-100 < E-value < 10e-50 Almost identical sequences. A long stretch of the query protein
is matched to the database.
• 10e-50 < E-value < 10e-10 Closely related sequences, could be a domain match or similar.
• 10e-10 < E-value < 1 Could be a true homologue but it is a gray area.
• E-value > 1 Proteins are most likely not related
• E-value > 10 Hits are most likely junk unless the query sequence is very short.
Gap costs
For blastp it is possible to specify gap cost for the chosen substitution matrix. There is only a
limited number of options for these parameters. The open gap cost is the price of introducing
gaps in the alignment, and extension gap cost is the price of every extension past the initial
opening gap. Increasing the gap costs will result in alignments with fewer gaps.
CHAPTER 12. BLAST SEARCH
181
Filters
It is possible to set different filter options before running the BLAST search. Low-complexity
regions have a very simple composition compared to the rest of the sequence and may result in
problems during the BLAST search [Wootton and Federhen, 1993]. A low complexity region of a
protein can for example look like this 'fftfflllsss', which in this case is a region as part of a signal
peptide. In the output of the BLAST search, low-complexity regions will be marked in lowercase
gray characters (default setting). The low complexity region cannot be thought of as a significant
match; thus, disabling the low complexity filter is likely to generate more hits to sequences which
are not truly related.
Word size
Change of the word size has a great impact on the seeded sequence space as described above.
But one can change the word size to find sequence matches which would otherwise not be found
using the default parameters. For instance the word size can be decreased when searching for
primers or short nucleotides. For blastn a suitable setting would be to decrease the default word
size of 11 to 7, increase the E-value significantly (1000) and turn off the complexity filtering.
For blastp a similar approach can be used. Decrease the word size to 2, increase the E-value
and use a more stringent substitution matrix, e.g. a PAM30 matrix.
Fortunately, the optimal search options for finding short, nearly exact matches can already be
found on the BLAST web pages http://www.ncbi.nlm.nih.gov/BLAST/.
Substitution matrix
For protein BLAST searches, a default substitution matrix is provided. If you are looking
at distantly related proteins, you should either choose a high-numbered PAM matrix or a
low-numbered BLOSUM matrix. See Bioinformatics Explained on scoring matrices on http:
//www.clcbio.com/be/. The default scoring matrix for blastp is BLOSUM62.
12.5.6
Explanation of the BLAST output
The BLAST output comes in different flavors. On the NCBI web page the default output is html,
and the following description will use the html output as example. Ordinary text and xml output
for easy computational parsing is also available.
The default layout of the NCBI BLAST result is a graphical representation of the hits found, a
table of sequence identifiers of the hits together with scoring information, and alignments of the
query sequence and the hits.
The graphical output (shown in figure 12.19) gives a quick overview of the query sequence and
the resulting hit sequences. The hits are colored according to the obtained alignment scores.
The table view (shown in figure 12.20) provides more detailed information on each hit and
furthermore acts as a hyperlink to the corresponding sequence in GenBank.
In the alignment view one can manually inspect the individual alignments generated by the BLAST
algorithm. This is particularly useful for detailed inspection of the sequence hit found(sbjct) and
the corresponding alignment. In the alignment view, all scores are described for each alignment,
CHAPTER 12. BLAST SEARCH
182
Figure 12.19: BLAST graphical view. A simple graphical overview of the hits found aligned to the
query sequence. The alignments are color coded ranging from black to red as indicated in the color
label at the top.
Figure 12.20: BLAST table view. A table view with one row per hit, showing the accession number
and description field from the sequence file together with BLAST output scores.
and the start and stop positions for the query and hit sequence are listed. The strand and
orientation for query sequence and hits are also found here.
In most cases, the table view of the results will be easier to interpret than tens of sequence
alignments.
CHAPTER 12. BLAST SEARCH
183
Figure 12.21: Alignment view of BLAST results. Individual alignments are represented together
with BLAST scores and more.
12.5.7
I want to BLAST against my own sequence database, is this possible?
It is possible to download the entire BLAST program package and use it on your own computer,
institution computer cluster or similar. This is preferred if you want to search in proprietary
sequences or sequences unavailable in the public databases stored at NCBI. The downloadable
BLAST package can either be installed as a web-based tool or as a command line tool. It is
available for a wide range of different operating systems.
The BLAST package can be downloaded free of charge from the following location http:
//www.ncbi.nlm.nih.gov/BLAST/download.shtml
Pre-formatted databases are available from a dedicated BLAST ftp site ftp://ftp.ncbi.nlm.
nih.gov/blast/db/. Moreover, it is possible to download programs/scripts from the same
site enabling automatic download of changed BLAST databases. Thus it is possible to schedule
a nightly update of changed databases and have the updated BLAST database stored locally or
on a shared network drive at all times. Most BLAST databases on the NCBI site are updated on
a daily basis to include all recent sequence submissions to GenBank.
A few commercial software packages are available for searching your own data. The advantage
of using a commercial program is obvious when BLAST is integrated with the existing tools of
these programs. Furthermore, they let you perform BLAST searches and retain annotations on
the query sequence (see figure 12.22). It is also much easier to batch download a selection of
hit sequences for further inspection.
CHAPTER 12. BLAST SEARCH
184
Figure 12.22: Snippet of alignment view of BLAST results from CLC Main Workbench. Individual
alignments are represented directly in a graphical view. The top sequence is the query sequence
and is shown with a selection of annotations.
12.5.8
What you cannot get out of BLAST
Don't expect BLAST to produce the best available alignment. BLAST is a heuristic method which
does not guarantee the best results, and therefore you cannot rely on BLAST if you wish to find
all the hits in the database.
Instead, use the Smith-Waterman algorithm for obtaining the best possible local alignments [Smith
and Waterman, 1981].
BLAST only makes local alignments. This means that a great but short hit in another sequence
may not at all be related to the query sequence even though the sequences align well in a small
region. It may be a domain or similar.
It is always a good idea to be cautious of the material in the database. For instance, the
sequences may be wrongly annotated; hypothetical proteins are often simple translations of a
found ORF on a sequenced nucleotide sequence and may not represent a true protein.
Don't expect to see the best result using the default settings. As described above, the settings
should be adjusted according to the what kind of query sequence is used, and what kind of
results you want. It is a good idea to perform the same BLAST search with different settings to
get an idea of how they work. There is not a final answer on how to adjust the settings for your
particular sequence.
12.5.9
Other useful resources
The BLAST web page hosted at NCBI
http://www.ncbi.nlm.nih.gov/BLAST
Download pages for the BLAST programs
http://www.ncbi.nlm.nih.gov/BLAST/download.shtml
Download pages for pre-formatted BLAST databases
ftp://ftp.ncbi.nlm.nih.gov/blast/db/
O'Reilly book on BLAST
http://www.oreilly.com/catalog/blast/
Explanation of scoring/substitution matrices and more
http://www.clcbio.com/be/
CHAPTER 12. BLAST SEARCH
185
Creative Commons License
All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational
purposes, under the following conditions: You must attribute the work in its original form and
"CLC bio" has to be clearly labeled as author and provider of the work. You may not use this
work for commercial purposes. You may not alter, transform, nor build upon this work.
See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on
how to use the contents.
Chapter 13
3D molecule viewing
Contents
13.1 Importing structure files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 186
13.2 Viewing structure files . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
13.2.1
Moving and rotating . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 187
13.3 Selections and display of the 3D structure . . . . . . . . . . . . . . . . . . . 188
13.3.1
Coloring of the 3D structure . . . . . . . . . . . . . . . . . . . . . . . . . 188
13.3.2
Hierarchical view - changing how selections of the structure are displayed 189
13.4 3D Output . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 193
In order to understand protein function it is often valuable to see the actual three dimensional
structure of the protein. This is of course only possible if the structure of the protein has been
resolved and published. CLC Protein Workbench has an integrated viewer of structure files.
Structure files are usually deposited at the Protein DataBank (PDB) www.rcsb.org, where
protein structure files can be searched and downloaded.
13.1
Importing structure files
In order to view the three dimensional structure files there are different ways to import these.
The supported file formats are PDB and mmCIF which both can be downloaded from the Protein
DataBank (http://www.rcsb.org) and imported through the import menu (see section 7.1.1).
Another way to import structure files is if a structure file is found through a direct search
at the GenBank structure database ( http://www.ncbi.nlm.nih.gov/entrez/query.
fcgi?db=Structure). Read more about search for structures in section 11.3.
It is also possible to make a BLAST search against the PDB database. In the latter case,
structure files can be directly downloaded to the navigation area by clicking the Open structure
button below all the BLAST hits. Downloading structure files from a conducted BLAST search is
only possible if the results are shown in a BLAST table. (See figure 13.1). How to conduct a
BLAST search can be seen in section 12.1.1.
186
CHAPTER 13. 3D MOLECULE VIEWING
187
Figure 13.1: It is possible to open a structure file directly from the output of a conducted BLAST
search by clicking the Open Structure button.
13.2
Viewing structure files
An example of a 3D structure is shown in figure 13.2.
Figure 13.2: 3D view. Structure files can be opened, viewed and edited in several ways.
Structures can be rotated and moved using the mouse and keyboard. Pan mode (
enabled in order to rotate and move the sequence.
) must be
Note! It is only possible to view one structure file at a time, in order to limit the amount of
memory used.
13.2.1
Moving and rotating
Structure files are simply rotated by holding down the left mouse button while moving the mouse.
This will rotate the structure in the direction the mouse is moved. The structures can be freely
rotated in all directions.
Holding down the Ctrl on Windows or
on Mac key on the keyboard while dragging the mouse
CHAPTER 13. 3D MOLECULE VIEWING
188
moves the structure in the direction the mouse is moved. This is particularly useful if the view is
zoomed to cover only a small region of the protein structure.
Zoom in ( ) and zoom out ( ) on the structure is done by selecting the appropriate zoom tool
in the toolbar and clicking with the mouse on the view area. Alternatively, click and hold the left
mouse button while using either zoom tool and move the mouse up or down to zoom out or in
respectively. The view can be restored to display the entire structure by clicking the Fit width
( ) button on the toolbar (read more about zooming in section 3.3).
• Rotate mode
The structure is rotated when the "Pan mode" ( ) is selected in the toolbar. If the "pan
mode" is not enabled on the first view of a structure a warning is shown.
• Zoom mode
Use the zoom buttons on the toolbar to enable zoom mode. A single click with the mouse
will zoom slightly on the structure. Moreover, it is possible to zoom in and out on the
structure by keeping the left mouse button pressed while moving the mouse up and down.
• Move mode
It is possible to move the structure from side to side if the Ctrl key on Windows and
on Mac is pressed while dragging with the mouse.
13.3
key
Selections and display of the 3D structure
The view of the structure can be changed in several ways. All graphical changes are carried out
through the Side Panel. At the top, you can change the default coloring (Default colors and
Settings), and at the bottom you can change the representation of specific parts of the structure
in order to high-light e.g. an active site.
13.3.1
Coloring of the 3D structure
The default colors apply if nothing else has been specified in the Hierarchical view below (see
section 13.3.2):
• Atom type. Colors the atoms individually.
Carbon: Light grey
Oxygen: Red
Hydrogen: White
Nitrogen: Light blue
Sulphur: Yellow
Chlorine, Boron: Green
Phosphorus, Iron, Barium: Orange
Sodium: Blue
Magnesium: Forest green
Zn, Cu, Ni, Br: Brown
Ca, Mn, Al, Ti, Cr, Ag: Dark grey
CHAPTER 13. 3D MOLECULE VIEWING
189
F, Si, Au: Goldenrod
Iodine: Purple
Lithium: firebrick
Helium: Pink
Other: Deep pink
• Entities. This will color protein subunits and additional structures individually. Using the
view table, the user may select which colors are used to color subunits.
• Rainbow. This color mode will color the structure with rainbow colors along the sequence.
• Residue hydrophobicity. Colors the residues according to hydrophobicity.
In the Settings group, you can specify the background color to use. Default is black.
13.3.2
Hierarchical view - changing how selections of the structure are displayed
In the bottom of the Side Panel, you see the hierarchical view of the 3D structure (see an example
in figure 13.3).
Figure 13.3: Hierarchy view in the Side Panel.
The hierarchical view shows the structure in a detailed manner. Individual structure subunits,
residues, active sites, disulfide bridges or even down to the atom level can be selected individually
and colored accordingly.
CHAPTER 13. 3D MOLECULE VIEWING
190
You can show additional information from the hierarchical view by holding your mouse still for
one second (see an example in figure 13.4).
Figure 13.4: Details shown by holding the mouse cursor on a subunit.
For each item in the hierarchy view, you can apply special view settings. Simply click an item in
the hierarchy view and click the Settings button above. This will display the settings dialog as
shown in figure 13.5.
Figure 13.5: Customize appearance.
CHAPTER 13. 3D MOLECULE VIEWING
191
There are four tabs at the top. You can specify settings for each tab and then click OK to apply
and close the dialog. You can also click Apply which will keep the settings dialog visible. You will
then be able to select another item in the hierarchical view and apply settings for this also.
Atoms
The Atoms tab is shown in figure 13.5. At the top, you can choose to show atoms, and below
you can specify their appearance:
• Color. Clicking the color box allows you to select a color.
• Opacity. Determines the level of opacity.
• Atom size. The size of the atoms measured by vdW radius.
Bonds
The Bonds tab is shown in figure 13.6.
Figure 13.6: Customize appearance for bonds.
At the top, you can choose to show bonds, and below you can specify their appearance:
• Color. Clicking the color box allows you to select a color.
• Opacity. Determines the level of opacity.
Representations
The Representations tab is shown in figure 13.7.
At the top, you can choose to between four display models:
• Secondary structure.
CHAPTER 13. 3D MOLECULE VIEWING
192
Figure 13.7: Customize appearance for representations.
• Stick model.
• Both. Displaying both secondary structure and stick model.
• None. Will not display representations.
• Color. Clicking the color box allows you to select a color.
• Opacity. Determines the level of opacity.
Models
The Models tab is shown in figure 13.8.
At the top, you can choose to between three display
Figure 13.8: Customize appearance for models.
modes. This functionality is only applicable to NMR structures which have multiple resolved
structures, for X-ray structures only one structure is available:
CHAPTER 13. 3D MOLECULE VIEWING
193
• Selected model.
• All models.
• None. Will not display models.
• Color. Clicking the color box allows you to select a color.
• Opacity. Determines the level of opacity.
13.4
3D Output
The output of the 3D view is rendered on the screen in real time and changes to the preferences
are visible immediately. From CLC Protein Workbench you can export the visible part of the 3D
view to different graphic formats, by pressing the Graphics button ( ) on the Menu bar. This
will allow you to export in the following formats:
Format
Portable Network Graphics
JPEG
Tagged Image File
PostScript
Encapsulated PostScript
Portable Document Format
Scalable Vector Graphics
Suffix
.png
.jpg
.tif
.ps
.eps
.pdf
.svg
Type
bitmap
bitmap
bitmap
vector graphics
vector graphics
vector graphics
vector graphics
Printing is not fully implemented with the 3D editor. Should you wish to print a 3D view, this can
be done by either exporting to a graphics format and printing that or use the scheme below.
Windows:
• Adjust your 3D view in CLC Protein Workbench
• Press Print Screen on your keyboard (or Alt + Print Screen)
• Paste the result into an 'image editor' e.g. Paint or GIMP http://www.gimp.org/
• Crop (edit the screen shot)
• Save in your preferred file format and/or print
Mac:
• Set up your 3D view
• Press
+ shift + 3 (or
+ shift + 4) (to take screen shot)
• Open the saved file (.pdf or .png) in a 'image editor' e.g. GIMP http://www.gimp.org/
• Crop (edit the screen shot)
• Save in your preferred file format and/or print
CHAPTER 13. 3D MOLECULE VIEWING
Linux:
• Set up your 3D view
• e.g. use GIMP to take the screen shot http://www.gimp.org/
• Crop (edit the screen shot)
• Save in your preferred file format and/or print
194
Chapter 14
General sequence analyses
Contents
14.1 Shuffle sequence . . . . . . . . . . . . . . . . .
14.2 Dot plots . . . . . . . . . . . . . . . . . . . . . .
14.2.1 Create dot plots . . . . . . . . . . . . . . .
14.2.2 View dot plots . . . . . . . . . . . . . . . .
14.2.3 Bioinformatics explained: Dot plots . . . . .
14.2.4 Bioinformatics explained: Scoring matrices
14.3 Local complexity plot . . . . . . . . . . . . . . .
14.4 Sequence statistics . . . . . . . . . . . . . . . .
14.4.1 Bioinformatics explained: Protein statistics
14.5 Join sequences . . . . . . . . . . . . . . . . . .
14.6 Pattern Discovery . . . . . . . . . . . . . . . . .
14.6.1 Pattern discovery search parameters . . . .
14.6.2 Pattern search output . . . . . . . . . . . .
14.7 Motif Search . . . . . . . . . . . . . . . . . . . .
14.7.1 Dynamic motifs . . . . . . . . . . . . . . .
14.7.2 Motif search from the Toolbox . . . . . . .
14.7.3 Java regular expressions . . . . . . . . . .
14.7.4 Create motif list . . . . . . . . . . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
195
197
197
199
200
204
207
208
211
214
215
216
217
217
218
220
221
223
CLC Protein Workbench offers different kinds of sequence analyses, which apply to both protein
and DNA. The analyses are described in this chapter.
14.1
Shuffle sequence
In some cases, it is beneficial to shuffle a sequence. This is an option in the Toolbox menu under
General Sequence Analyses. It is normally used for statistical analyses, e.g. when comparing an
alignment score with the distribution of scores of shuffled sequences.
Shuffling a sequence removes all annotations that relate to the residues.
select sequence | Toolbox in the Menu Bar | General Sequence Analyses (
Shuffle Sequence ( )
195
) |
CHAPTER 14. GENERAL SEQUENCE ANALYSES
or right-click a sequence | Toolbox | General Sequence Analyses (
Sequence ( )
196
) | Shuffle
This opens the dialog displayed in figure 14.1:
Figure 14.1: Choosing sequence for shuffling.
If a sequence was selected before choosing the Toolbox action, this sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
Click Next to determine how the shuffling should be performed.
In this step, shown in figure 14.2:
For nucleotides, the following parameters can be set:
Figure 14.2: Parameters for shuffling.
• Mononucleotide shuffling. Shuffle method generating a sequence of the exact same
mononucleotide frequency
• Dinucleotide shuffling. Shuffle method generating a sequence of the exact same dinucleotide frequency
• Mononucleotide sampling from zero order Markov chain. Resampling method generating
a sequence of the same expected mononucleotide frequency.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
197
• Dinucleotide sampling from first order Markov chain. Resampling method generating a
sequence of the same expected dinucleotide frequency.
For proteins, the following parameters can be set:
• Single amino acid shuffling. Shuffle method generating a sequence of the exact same
amino acid frequency.
• Single amino acid sampling from zero order Markov chain. Resampling method generating
a sequence of the same expected single amino acid frequency.
• Dipeptide shuffling. Shuffle method generating a sequence of the exact same dipeptide
frequency.
• Dipeptide sampling from first order Markov chain. Resampling method generating a
sequence of the same expected dipeptide frequency.
For further details of these algorithms, see [Clote et al., 2005]. In addition to the shuffle method,
you can specify the number of randomized sequences to output.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
This will open a new view in the View Area displaying the shuffled sequence. The new sequence
is not saved automatically. To save the sequence, drag it into the Navigation Area or press ctrl
+ S ( + S on Mac) to activate a save dialog.
14.2
Dot plots
Dot plots provide a powerful visual comparison of two sequences. Dot plots can also be used to
compare regions of similarity within a sequence. This chapter first describes how to create and
second how to adjust the view of the plot.
14.2.1
Create dot plots
A dot plot is a simple, yet intuitive way of comparing two sequences, either DNA or protein, and is
probably the oldest way of comparing two sequences [Maizel and Lenk, 1981]. A dot plot is a 2
dimensional matrix where each axis of the plot represents one sequence. By sliding a fixed size
window over the sequences and making a sequence match by a dot in the matrix, a diagonal line
will emerge if two identical (or very homologous) sequences are plotted against each other. Dot
plots can also be used to visually inspect sequences for direct or inverted repeats or regions with
low sequence complexity. Various smoothing algorithms can be applied to the dot plot calculation
to avoid noisy background of the plot. Moreover, can various substitution matrices be applied in
order to take the evolutionary distance of the two sequences into account.
To create a dot plot:
Toolbox | General Sequence Analyses (
) | Create Dot Plot (
)
or Select one or two sequences in the Navigation Area | Toolbox in the Menu Bar |
General Sequence Analyses ( ) | Create Dot Plot ( )
CHAPTER 14. GENERAL SEQUENCE ANALYSES
198
or Select one or two sequences in the Navigation Area | right-click in the Navigation
Area | Toolbox | General Sequence Analyses ( ) | Create Dot Plot ( )
This opens the dialog shown in figure 14.3.
Figure 14.3: Selecting sequences for the dot plot.
If a sequence was selected before choosing the Toolbox action, this sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove elements from
the selected elements. Click Next to adjust dot plot parameters. Clicking Next opens the dialog
shown in figure 14.4.
Notice! Calculating dot plots take up a considerable amount of memory in the computer.
Therefore, you see a warning if the sum of the number of nucleotides/amino acids in the
sequences is higher than 8000. If you insist on calculating a dot plot with more residues the
Workbench may shut down, allowing you to save your work first. However, this depends on your
computer's memory configuration.
Adjust dot plot parameters
There are two parameters for calculating the dot plot:
• Distance correction (only valid for protein sequences) In order to treat evolutionary
transitions of amino acids, a distance correction measure can be used when calculating
the dot plot. These distance correction matrices (substitution matrices) take into account
the likeliness of one amino acid changing to another.
• Window size A residue by residue comparison (window size = 1) would undoubtedly result in
a very noisy background due to a lot of similarities between the two sequences of interest.
For DNA sequences the background noise will be even more dominant as a match between
only four nucleotide is very likely to happen. Moreover, a residue by residue comparison
(window size = 1) can be very time consuming and computationally demanding. Increasing
the window size will make the dot plot more 'smooth'.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
199
Figure 14.4: Setting the dot plot parameters.
14.2.2
View dot plots
A view of a dot plot can be seen in figure 14.5. You can select Zoom in (
click the dot plot to zoom in to see the details of particular areas.
) in the Toolbar and
Figure 14.5: A view is opened showing the dot plot.
The Side Panel to the right let you specify the dot plot preferences. The gradient color box can
be adjusted to get the appropriate result by dragging the small pointers at the top of the box.
Moving the slider from the right to the left lowers the thresholds which can be directly seen in
the dot plot, where more diagonal lines will emerge. You can also choose another color gradient
by clicking on the gradient box and choose from the list.
Adjusting the sliders above the gradient box is also practical, when producing an output for
printing. (Too much background color might not be desirable). By crossing one slider over the
other (the two sliders change side) the colors are inverted, allowing for a white background. (If
you choose a color gradient, which includes white). Se figure 14.5.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
200
Figure 14.6: Dot plot with inverted colors, practical for printing.
14.2.3
Bioinformatics explained: Dot plots
Realization of dot plots
Dot plots are two-dimensional plots where the x-axis and y-axis each represents a sequence
and the plot itself shows a comparison of these two sequences by a calculated score for each
position of the sequence. If a window of fixed size on one sequence (one axis) match to the other
sequence a dot is drawn at the plot. Dot plots are one of the oldest methods for comparing two
sequences [Maizel and Lenk, 1981].
The scores that are drawn on the plot are affected by several issues.
• Scoring matrix for distance correction.
Scoring matrices (BLOSUM and PAM) contain substitution scores for every combination of
two amino acids. Thus, these matrices can only be used for dot plots of protein sequences.
• Window size
The single residue comparison (bit by bit comparison(window size = 1)) in dot plots will
undoubtedly result in a noisy background of the plot. You can imagine that there are many
successes in the comparison if you only have four possible residues like in nucleotide
sequences. Therefore you can set a window size which is smoothing the dot plot. Instead
of comparing single residues it compares subsequences of length set as window size. The
score is now calculated with respect to aligning the subsequences.
• Threshold
The dot plot shows the calculated scores with colored threshold. Hence you can better
recognize the most important similarities.
Examples and interpretations of dot plots
Contrary to simple sequence alignments dot plots can be a very useful tool for spotting various
evolutionary events which may have happened to the sequences of interest.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
201
Below is shown some examples of dot plots where sequence insertions, low complexity regions,
inverted repeats etc. can be identified visually.
Similar sequences
The most simple example of a dot plot is obtained by plotting two homologous sequences of
interest. If very similar or identical sequences are plotted against each other a diagonal line will
occur.
The dot plot in figure 14.7 shows two related sequences of the Influenza A virus nucleoproteins
infecting ducks and chickens. Accession numbers from the two sequences are: DQ232610
and DQ023146. Both sequences can be retrieved directly from http://www.ncbi.nlm.nih.
gov/gquery/gquery.fcgi.
Figure 14.7: Dot plot of DQ232610 vs. DQ023146 (Influenza A virus nucleoproteins) showing and
overall similarity
Repeated regions
Sequence repeats can also be identified using dot plots. A repeat region will typically show up as
lines parallel to the diagonal line.
If the dot plot shows more than one diagonal in the same region of a sequence, the regions
depending to the other sequence are repeated. In figure 14.9 you can see a sequence with
repeats.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
202
Figure 14.8: Direct and inverted repeats shown on an amino acid sequence generated for
demonstration purposes.
Figure 14.9: The dot plot of a sequence showing repeated elements. See also figure 14.8.
Frame shifts
Frame shifts in a nucleotide sequence can occur due to insertions, deletions or mutations. Such
frame shifts can be visualized in a dot plot as seen in figure 14.10. In this figure, three frame
shifts for the sequence on the y-axis are found.
1. Deletion of nucleotides
2. Insertion of nucleotides
3. Mutation (out of frame)
Sequence inversions
CHAPTER 14. GENERAL SEQUENCE ANALYSES
203
Figure 14.10: This dot plot show various frame shifts in the sequence. See text for details.
In dot plots you can see an inversion of sequence as contrary diagonal to the diagonal showing
similarity. In figure 14.11 you can see a dot plot (window length is 3) with an inversion.
Low-complexity regions
Low-complexity regions in sequences can be found as regions around the diagonal all obtaining
a high score. Low complexity regions are calculated from the redundancy of amino acids within a
limited region [Wootton and Federhen, 1993]. These are most often seen as short regions of only
a few different amino acids. In the middle of figure 14.12 is a square shows the low-complexity
region of this sequence.
Creative Commons License
All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational
purposes, under the following conditions: You must attribute the work in its original form and
"CLC bio" has to be clearly labeled as author and provider of the work. You may not use this
work for commercial purposes. You may not alter, transform, nor build upon this work.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
204
Figure 14.11: The dot plot showing a inversion in a sequence. See also figure 14.8.
See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on
how to use the contents.
14.2.4
Bioinformatics explained: Scoring matrices
Biological sequences have evolved throughout time and evolution has shown that not all changes
to a biological sequence is equally likely to happen. Certain amino acid substitutions (change of
one amino acid to another) happen often, whereas other substitutions are very rare. For instance,
tryptophan (W) which is a relatively rare amino acid, will only --- on very rare occasions --- mutate
into a leucine (L).
Based on evolution of proteins it became apparent that these changes or substitutions of amino
acids can be modeled by a scoring matrix also refereed to as a substitution matrix. See an
example of a scoring matrix in table 14.1. This matrix lists the substitution scores of every
single amino acid. A score for an aligned amino acid pair is found at the intersection of the
corresponding column and row. For example, the substitution score from an arginine (R) to
a lysine (K) is 2. The diagonal show scores for amino acids which have not changed. Most
substitutions changes have a negative score. Only rounded numbers are found in this matrix.
The two most used matrices are the BLOSUM [Henikoff and Henikoff, 1992] and PAM [Dayhoff
and Schwartz, 1978].
CHAPTER 14. GENERAL SEQUENCE ANALYSES
205
Figure 14.12: The dot plot showing a low-complexity region in the sequence. The sequence is
artificial and low complexity regions does not always show as a square.
Different scoring matrices
PAM
The first PAM matrix (Point Accepted Mutation) was published in 1978 by Dayhoff et al. The PAM
matrix was build through a global alignment of related sequences all having sequence similarity
above 85% [Dayhoff and Schwartz, 1978]. A PAM matrix shows the probability that any given
amino acid will mutate into another in a given time interval. As an example, PAM1 gives that one
amino acid out of a 100 will mutate in a given time interval. In the other end of the scale, a
PAM256 matrix, gives the probability of 256 mutations in a 100 amino acids (see figure 14.13).
There are some limitation to the PAM matrices which makes the BLOSUM matrices somewhat
more attractive. The dataset on which the initial PAM matrices were build is very old by now, and
the PAM matrices assume that all amino acids mutate at the same rate - this is not a correct
assumption.
BLOSUM
In 1992, 14 years after the PAM matrices were published, the BLOSUM matrices (BLOcks
SUbstitution Matrix) were developed and published [Henikoff and Henikoff, 1992].
Henikoff et al. wanted to model more divergent proteins, thus they used locally aligned
sequences where none of the aligned sequences share less than 62% identity. This resulted
CHAPTER 14. GENERAL SEQUENCE ANALYSES
A
R
N
D
C
Q
E
G
H
I
L
K
M
F
P
S
T
W
Y
V
A
4
-1
-2
-2
0
-1
-1
0
-2
-1
-1
-1
-1
-2
-1
1
0
-3
-2
0
R
-1
5
0
-2
-3
1
0
-2
0
-3
-2
2
-1
-3
-2
-1
-1
-3
-2
-3
N
-2
0
6
1
-3
0
0
0
1
-3
-3
0
-2
-3
-2
1
0
-4
-2
-3
D
-2
-2
1
6
-3
0
2
-1
-1
-3
-4
-1
-3
-3
-1
0
-1
-4
-3
-3
C
0
-3
-3
-3
9
-3
-4
-3
-3
-1
-1
-3
-1
-2
-3
-1
-1
-2
-2
-1
Q
-1
1
0
0
-3
5
2
-2
0
-3
-2
1
0
-3
-1
0
-1
-2
-1
-2
E
-1
0
0
2
-4
2
5
-2
0
-3
-3
1
-2
-3
-1
0
-1
-3
-2
-2
G
0
-2
0
-1
-3
-2
-2
6
-2
-4
-4
-2
-3
-3
-2
0
-2
-2
-3
-3
H
-2
0
1
-1
-3
0
0
-2
8
-3
-3
-1
-2
-1
-2
-1
-2
-2
2
-3
I
-1
-3
-3
-3
-1
-3
-3
-4
-3
4
2
-3
1
0
-3
-2
-1
-3
-1
3
206
L
-1
-2
-3
-4
-1
-2
-3
-4
-3
2
4
-2
2
0
-3
-2
-1
-2
-1
1
K
-1
2
0
-1
-3
1
1
-2
-1
-3
-2
5
-1
-3
-1
0
-1
-3
-2
-2
M
-1
-1
-2
-3
-1
0
-2
-3
-2
1
2
-1
5
0
-2
-1
-1
-1
-1
1
F
-2
-3
-3
-3
-2
-3
-3
-3
-1
0
0
-3
0
6
-4
-2
-2
1
3
-1
P
-1
-2
-2
-1
-3
-1
-1
-2
-2
-3
-3
-1
-2
-4
7
-1
-1
-4
-3
-2
S
1
-1
1
0
-1
0
0
0
-1
-2
-2
0
-1
-2
-1
4
1
-3
-2
-2
T
0
-1
0
-1
-1
-1
-1
-2
-2
-1
-1
-1
-1
-2
-1
1
5
-2
-2
0
W
-3
-3
-4
-4
-2
-2
-3
-2
-2
-3
-2
-3
-1
1
-4
-3
-2
11
2
-3
Y
-2
-2
-2
-3
-2
-1
-2
-3
2
-1
-1
-2
-1
3
-3
-2
-2
2
7
-1
V
0
-3
-3
-3
-1
-2
-2
-3
-3
3
1
-2
1
-1
-2
-2
0
-3
-1
4
Table 14.1: The BLOSUM62 matrix. A tabular view of the BLOSUM62 matrix containing all
possible substitution scores [Henikoff and Henikoff, 1992].
in a scoring matrix called BLOSUM62. In contrast to the PAM matrices the BLOSUM matrices
are calculated from alignments without gaps emerging from the BLOCKS database http:
//blocks.fhcrc.org/.
Sean Eddy recently wrote a paper reviewing the BLOSUM62 substitution matrix and how to
calculate the scores [Eddy, 2004].
Use of scoring matrices
Deciding which scoring matrix you should use in order of obtain the best alignment results is a
difficult task. If you have no prior knowledge on the sequence the BLOSUM62 is probably the
best choice. This matrix has become the de facto standard for scoring matrices and is also used
as the default matrix in BLAST searches. The selection of a "wrong" scoring matrix will most
probable strongly influence on the outcome of the analysis. In general a few rules apply to the
selection of scoring matrices.
• For closely related sequences choose BLOSUM matrices created for highly similar alignments, like BLOSUM80. You can also select low PAM matrices such as PAM1.
• For distant related sequences, select low BLOSUM matrices (for example BLOSUM45) or
high PAM matrices such as PAM250.
The BLOSUM matrices with low numbers correspond to PAM matrices with high numbers. (See
figure 14.13) for correlations between the PAM and BLOSUM matrices. To summarize, if you
want to find distant related proteins to a sequence of interest using BLAST, you could benefit of
using BLOSUM45 or similar matrices.
Other useful resources
CHAPTER 14. GENERAL SEQUENCE ANALYSES
207
Figure 14.13: Relationship between scoring matrices. The BLOSUM62 has become a de facto
standard scoring matrix for a wide range of alignment programs. It is the default matrix in BLAST.
Calculate your own PAM matrix
http://www.bioinformatics.nl/tools/pam.html
BLOKS database
http://blocks.fhcrc.org/
NCBI help site
http://www.ncbi.nlm.nih.gov/Education/BLASTinfo/Scoring2.html
Creative Commons License
All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational
purposes, under the following conditions: You must attribute the work in its original form and
"CLC bio" has to be clearly labeled as author and provider of the work. You may not use this
work for commercial purposes. You may not alter, transform, nor build upon this work.
See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on
how to use the contents.
14.3
Local complexity plot
In CLC Protein Workbench it is possible to calculate local complexity for both DNA and protein
sequences. The local complexity is a measure of the diversity in the composition of amino acids
within a given range (window) of the sequence. The K2 algorithm is used for calculating local
complexity [Wootton and Federhen, 1993]. To conduct a complexity calculation do the following:
Select sequences in Navigation Area | Toolbox in Menu Bar | General Sequence
Analyses ( ) | Create Complexity Plot ( )
This opens a dialog. In Step 1 you can change, remove and add DNA and protein sequences.
When the relevant sequences are selected, clicking Next takes you to Step 2. This step allows
you to adjust the window size from which the complexity plot is calculated. Default is set to 11
amino acids and the number should always be odd. The higher the number, the less volatile the
graph.
Figure 14.14 shows an example of a local complexity plot.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
208
Figure 14.14: An example of a local complexity plot.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
The values of the complexity plot approaches 1.0 as the distribution of amino acids become
more complex.
See section B in the appendix for information about the graph view.
14.4
Sequence statistics
CLC Protein Workbench can produce an output with many relevant statistics for protein sequences.
Some of the statistics are also relevant to produce for DNA sequences. Therefore, this section
deals with both types of statistics. The required steps for producing the statistics are the same.
To create a statistic for the sequence, do the following:
select sequence(s) | Toolbox in the Menu Bar | General Sequence Analyses (
Create Sequence Statistics ( )
)|
This opens a dialog where you can alter your choice of sequences which you want to create
statistics for. You can also add sequence lists.
Note! You cannot create statistics for DNA and protein sequences at the same time.
When the sequences are selected, click Next.
This opens the dialog displayed in figure 14.15.
The dialog offers to adjust the following parameters:
• Individual statistics layout. If more sequences were selected in Step 1, this function
generates separate statistics for each sequence.
• Comparative statistics layout. If more sequences were selected in Step 1, this function
generates statistics with comparisons between the sequences.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
209
Figure 14.15: Setting parameters for the sequence statistics.
You can also choose to include Background distribution of amino acids. If this box is ticked, an
extra column with amino acid distribution of the chosen species, is included in the table output.
(The distributions are calculated from UniProt www.uniprot.org version 6.0, dated September
13 2005.)
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
An example of protein sequence statistics is shown in figure 14.16.
Figure 14.16: Comparative sequence statistics.
Nucleotide sequence statistics are generated using the same dialog as used for protein sequence
statistics. However, the output of Nucleotide sequence statistics is less extensive than that of
the protein sequence statistics.
Note! The headings of the tables change depending on whether you calculate 'individual' or
'comparative' sequence statistics.
The output of comparative protein sequence statistics include:
• Sequence information:
Sequence type
Length
Organism
CHAPTER 14. GENERAL SEQUENCE ANALYSES
210
Name
Description
Modification Date
Weight. This is calculated like this: sumunitsinsequence (weight(unit)) − links ∗
weight(H2O) where links is the sequence length minus one and units are
amino acids. The atomic composition is defined the same way.
Isoelectric point
Aliphatic index
• Half-life
• Extinction coefficient
• Counts of Atoms
• Frequency of Atoms
• Count of hydrophobic and hydrophilic residues
• Frequencies of hydrophobic and hydrophilic residues
• Count of charged residues
• Frequencies of charged residues
• Amino acid distribution
• Histogram of amino acid distribution
• Annotation table
• Counts of di-peptides
• Frequency of di-peptides
The output of nucleotide sequence statistics include:
• General statistics:
Sequence type
Length
Organism
Name
Description
Modification Date
Weight. This is calculated like this: sumunitsinsequence (weight(unit)) − links ∗
weight(H2O) where links is the sequence length minus one for linear sequences
and sequence length for circular molecules. The units are monophosphates. Both
the weight for single- and double stranded molecules are includes. The atomic
composition is defined the same way.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
211
• Atomic composition
• Nucleotide distribution table
• Nucleotide distribution histogram
• Annotation table
• Counts of di-nucleotides
• Frequency of di-nucleotides
A short description of the different areas of the statistical output is given in section 14.4.1.
14.4.1
Bioinformatics explained: Protein statistics
Every protein holds specific and individual features which are unique to that particular protein.
Features such as isoelectric point or amino acid composition can reveal important information of
a novel protein. Many of the features described below are calculated in a simple way.
Molecular weight
The molecular weight is the mass of a protein or molecule. The molecular weight is simply
calculated as the sum of the atomic mass of all the atoms in the molecule.
The weight of a protein is usually represented in Daltons (Da).
A calculation of the molecular weight of a protein does not usually include additional posttranslational modifications. For native and unknown proteins it tends to be difficult to assess whether
posttranslational modifications such as glycosylations are present on the protein, making a
calculation based solely on the amino acid sequence inaccurate. The molecular weight can be
determined very accurately by mass-spectrometry in a laboratory.
Isoelectric point
The isoelectric point (pI) of a protein is the pH where the proteins has no net charge. The pI is
calculated from the pKa values for 20 different amino acids. At a pH below the pI, the protein
carries a positive charge, whereas if the pH is above pI the proteins carry a negative charge. In
other words, pI is high for basic proteins and low for acidic proteins. This information can be
used in the laboratory when running electrophoretic gels. Here the proteins can be separated,
based on their isoelectric point.
Aliphatic index
The aliphatic index of a protein is a measure of the relative volume occupied by aliphatic side
chain of the following amino acids: alanine, valine, leucine and isoleucine. An increase in the
aliphatic index increases the thermostability of globular proteins. The index is calculated by the
following formula.
Aliphaticindex = X(Ala) + a ∗ X(V al) + b ∗ X(Leu) + b ∗ (X)Ile
CHAPTER 14. GENERAL SEQUENCE ANALYSES
Amino acid
Ala (A)
Cys (C)
Asp (D)
Glu (E)
Phe (F)
Gly (G)
His (H)
Ile (I)
Lys (K)
Leu (L)
Met (M)
Asn (N)
Pro (P)
Gln (Q)
Arg (R)
Ser (S)
Thr (T)
Val (V)
Trp (W)
Tyr (Y)
Mammalian
4.4 hour
1.2 hours
1.1 hours
1 hour
1.1 hours
30 hours
3.5 hours
20 hours
1.3 hours
5.5 hours
30 hours
1.4 hours
>20 hours
0.8 hour
1 hour
1.9 hours
7.2 hours
100 hours
2.8 hours
2.8 hours
212
Yeast
>20 hours
>20 hours
3 min
30 min
3 min
>20 hours
10 min
30 min
3 min
3 min
>20 hours
3 min
>20 hours
10 min
2 min
>20 hours
>20 hours
>20 hours
3 min
10 min
E. coli
>10 hours
>10 hours
>10 hours
>10 hours
2 min
>10 hours
>10 hours
>10 hours
2 min
2 min
>10 hours
>10 hours
?
>10 hours
2 min
>10 hours
>10 hours
>10 hours
2 min
2 min
Table 14.2: Estimated half life. Half life of proteins where the N-terminal residue is listed in the
first column and the half-life in the subsequent columns for mammals, yeast and E. coli.
X(Ala), X(Val), X(Ile) and X(Leu) are the amino acid compositional fractions. The constants a and
b are the relative volume of valine (a=2.9) and leucine/isoleucine (b=3.9) side chains compared
to the side chain of alanine [Ikai, 1980].
Estimated half-life
The half life of a protein is the time it takes for the protein pool of that particular protein to be
reduced to the half. The half life of proteins is highly dependent on the presence of the N-terminal
amino acid, thus overall protein stability [Bachmair et al., 1986, Gonda et al., 1989, Tobias
et al., 1991]. The importance of the N-terminal residues is generally known as the 'N-end rule'.
The N-end rule and consequently the N-terminal amino acid, simply determines the half-life of
proteins. The estimated half-life of proteins have been investigated in mammals, yeast and E. coli
(see Table 14.2). If leucine is found N-terminally in mammalian proteins the estimated half-life is
5.5 hours.
Extinction coefficient
This measure indicates how much light is absorbed by a protein at a particular wavelength. The
extinction coefficient is measured by UV spectrophotometry, but can also be calculated. The
amino acid composition is important when calculating the extinction coefficient. The extinction
coefficient is calculated from the absorbance of cysteine, tyrosine and tryptophan using the
following equation:
Ext(P rotein) = count(Cystine)∗Ext(Cystine)+count(T yr)∗Ext(T yr)+count(T rp)∗Ext(T rp)
CHAPTER 14. GENERAL SEQUENCE ANALYSES
213
where Ext is the extinction coefficient of amino acid in question. At 280nm the extinction
coefficients are: Cys=120, Tyr=1280 and Trp=5690.
This equation is only valid under the following conditions:
• pH 6.5
• 6.0 M guanidium hydrochloride
• 0.02 M phosphate buffer
The extinction coefficient values of the three important amino acids at different wavelengths are
found in [Gill and von Hippel, 1989].
Knowing the extinction coefficient, the absorbance (optical density) can be calculated using the
following formula:
Absorbance(P rotein) =
Ext(P rotein)
M olecular weight
Two values are reported. The first value is computed assuming that all cysteine residues appear
as half cystines, meaning they form di-sulfide bridges to other cysteines. The second number
assumes that no di-sulfide bonds are formed.
Atomic composition
Amino acids are indeed very simple compounds. All 20 amino acids consist of combinations of
only five different atoms. The atoms which can be found in these simple structures are: Carbon,
Nitrogen, Hydrogen, Sulfur, Oxygen. The atomic composition of a protein can for example be
used to calculate the precise molecular weight of the entire protein.
Total number of negatively charged residues (Asp+Glu)
At neutral pH, the fraction of negatively charged residues provides information about the location
of the protein. Intracellular proteins tend to have a higher fraction of negatively charged residues
than extracellular proteins.
Total number of positively charged residues (Arg+Lys)
At neutral pH, nuclear proteins have a high relative percentage of positively charged amino acids.
Nuclear proteins often bind to the negatively charged DNA, which may regulate gene expression or
help to fold the DNA. Nuclear proteins often have a low percentage of aromatic residues [Andrade
et al., 1998].
Amino acid distribution
Amino acids are the basic components of proteins. The amino acid distribution in a protein
is simply the percentage of the different amino acids represented in a particular protein of
interest. Amino acid composition is generally conserved through family-classes in different
organisms which can be useful when studying a particular protein or enzymes across species
borders. Another interesting observation is that amino acid composition variate slightly between
CHAPTER 14. GENERAL SEQUENCE ANALYSES
214
proteins from different subcellular localizations. This fact has been used in several computational
methods, used for prediction of subcellular localization.
Annotation table
This table provides an overview of all the different annotations associated with the sequence and
their incidence.
Dipeptide distribution
This measure is simply a count, or frequency, of all the observed adjacent pairs of amino acids
(dipeptides) found in the protein. It is only possible to report neighboring amino acids. Knowledge
on dipeptide composition have previously been used for prediction of subcellular localization.
Creative Commons License
All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational
purposes, under the following conditions: You must attribute the work in its original form and
"CLC bio" has to be clearly labeled as author and provider of the work. You may not use this
work for commercial purposes. You may not alter, transform, nor build upon this work.
See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on
how to use the contents.
14.5
Join sequences
CLC Protein Workbench can join several nucleotide or protein sequences into one sequence. This
feature can for example be used to construct "supergenes" for phylogenetic inference by joining
several disjoint genes into one. Note, that when sequences are joined, all their annotations are
carried over to the new spliced sequence.
Two (or more) sequences can be joined by:
select sequences to join | Toolbox in the Menu Bar | General Sequence Analyses |
Join sequences ( )
or select sequences to join | right-click any selected sequence | Toolbox | General
Sequence Analyses | Join sequences ( )
This opens the dialog shown in figure 14.17.
If you have selected some sequences before choosing the Toolbox action, they are now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences from
the selected elements. Click Next opens the dialog shown in figure 14.18.
In step 2 you can change the order in which the sequences will be joined. Select a sequence and
use the arrows to move the selected sequence up or down.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
215
Figure 14.17: Selecting two sequences to be joined.
Figure 14.18: Setting the order in which sequences are joined.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
The result is shown in figure 14.19.
Figure 14.19: The result of joining sequences is a new sequence containing the annotations of the
joined sequences (they each had a HBB annotation).
14.6
Pattern Discovery
With CLC Protein Workbench you can perform pattern discovery on both DNA and protein
sequences. Advanced hidden Markov models can help to identify unknown sequence patterns
across single or even multiple sequences.
In order to search for unknown patterns:
CHAPTER 14. GENERAL SEQUENCE ANALYSES
216
Select DNA or protein sequence(s) | Toolbox in the Menu Bar | General Sequence
Analyses ( ) | Pattern Discovery ( )
or right-click DNA or protein sequence(s) | Toolbox | General Sequence Analyses (
| Pattern Discovery ( )
)
If a sequence was selected before choosing the Toolbox action, the sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
You can perform the analysis on several DNA or several protein sequences at a time. If the
analysis is performed on several sequences at a time the method will search for patterns which
is common between all the sequences. Annotations will be added to all the sequences and a
view is opened for each sequence.
Click Next to adjust parameters (see figure 14.20).
Figure 14.20: Setting parameters for the pattern discovery. See text for details.
In order to search unknown sequences with an already existing model:
Select to use an already existing model which is seen in figure 14.20. Models are represented
with the following icon in the navigation area ( ).
14.6.1
Pattern discovery search parameters
Various parameters can be set prior to the pattern discovery. The parameters are listed below
and a screen shot of the parameter settings can be seen in figure 14.20.
• Create and search with new model. This will create a new HMM model based on the
selected sequences. The found model will be opened after the run and presented in a table
view. It can be saved and used later if desired.
• Use existing model. It is possible to use already created models to search for the same
pattern in new sequences.
• Minimum pattern length. Here, the minimum length of patterns to search for, can be
specified.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
217
• Maximum pattern length. Here, the maximum length of patterns to search for, can be
specified.
• Noise (%). Specify noise-level of the model. This parameter has influence on the level
of degeneracy of patterns in the sequence(s). The noise parameter can be 1,2,5 or 10
percent.
• Number of different kinds of patterns to predict. Number of iterations the algorithm goes
through. After the first iteration, we force predicted pattern-positions in the first run to be
member of the background: In that way, the algorithm finds new patterns in the second
iteration. Patterns marked 'Pattern1' have the highest confidence. The maximal iterations
to go through is 3.
• Include background distribution. For protein sequences it is possible to include information
on the background distribution of amino acids from a range of organisms.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
This will open a view showing the patterns found as annotations on the original sequence (see
figure 14.21). If you have selected several sequences, a corresponding number of views will be
opened.
Figure 14.21: Sequence view displaying two discovered patterns.
14.6.2
Pattern search output
If the analysis is performed on several sequences at a time the method will search for patterns
in the sequences and open a new view for each of the sequences, in which a pattern was
discovered. Each novel pattern will be represented as an annotation of the type Region. More
information on each found pattern is available through the tool-tip, including detailed information
on the position of the pattern and quality scores.
It is also possible to get a tabular view of all found patterns in one combined table. Then each
found pattern will be represented with various information on obtained scores, quality of the
pattern and position in the sequence.
A table view of emission values of the actual used HMM model is presented in a table view. This
model can be saved and used to search for a similar pattern in new or unknown sequences.
14.7
Motif Search
CLC Protein Workbench offers advanced and versatile options to search for known motifs
represented either by a simple sequence or a more advanced regular expression. These
advanced search capabilities are available for use in both DNA and protein sequences.
There are two ways to access this functionality:
CHAPTER 14. GENERAL SEQUENCE ANALYSES
218
• When viewing sequences, it is possible to have motifs calculated and shown on the
sequence in a similar way as restriction sites (see section 17.1). This approach is called
Dynamic motifs and is an easy way to spot known sequence motifs when working with
sequences for cloning etc.
• For more refined and systematic search for motifs can be performed through the Toolbox.
This will generate a table and optionally add annotations to the sequences.
The two approaches are described below.
14.7.1
Dynamic motifs
In the Side Panel of sequence views, there is a group called Motifs (see figure 14.22).
Figure 14.22: Dynamic motifs in the Side Panel.
The Workbench will look for the listed motifs in the sequence that is open and by clicking the
check box next to the motif it will be shown in the view as illustrated in figure 14.23.
Figure 14.23: Showing dynamic motifs on the sequence.
This case shows the CMV promoter primer sequence which is one of the pre-defined motifs in
CLC Protein Workbench. The motif is per default shown as a faded arrow with no text. The
direction of the arrow indicates the strand of the motif.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
219
Placing the mouse cursor on the arrow will display additional information about the motif as
illustrated in figure 14.24.
Figure 14.24: Showing dynamic motifs on the sequence.
To add Labels to the motif, select the Flag or Stacked option. They will put the name of the motif
as a flag above the sequence. The stacked option will stack the labels when there is more than
one motif so that all labels are shown.
Below the labels option there are two options for controlling the way the sequence should be
searched for motifs:
• Include reverse motifs. This will also find motifs on the negative strand (only available for
nucleotide sequences)
• Exclude matches in N-regions for simple motifs. The motif search handles ambiguous
characters in the way that two residues are different if they do not have any residues in
common. For example: For nucleotides, N matches any character and R matches A,G. For
proteins, X matches any character and Z matches E,Q. Genome sequence often have large
regions with unknown sequence. These regions are very often padded with N's. Ticking this
checkbox will not display hits found in N-regions and if a one residue in a motif matches to
an N, it will be treated as a mismatch.
The list of motifs shown in figure 14.22 is a pre-defined list that is included with the CLC Protein
Workbench. You can define your own set of motifs to use instead. In order to do this, you first
need to create a Motif list ( ) (see section 14.7.4) and then click the Manage Motifs button.
This will bring up the dialog shown in figure 14.25.
Figure 14.25: Managing the motifs to be shown.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
220
At the top, select a motif list by clicking the Browse ( ) button. When the motif list is selected,
its motifs are listed in the panel in the left-hand side of the dialog. The right-hand side panel
contains the motifs that will be listed in the Side Panel when you click Finish.
14.7.2
Motif search from the Toolbox
The dynamic motifs described in section 14.7.1 provide a quick way of routinely scanning a
sequence for commonly used motifs, but in some cases a more systematic approach is needed.
The motif search in the Toolbox provides an option to search for motifs with a user-specified
similarity to the target sequence, and furthermore the motifs found can be displayed in an
overview table. This is particularly useful when searching for motifs on many sequences.
To start the Toolbox motif search:
Toolbox | General Sequence Analyses (
) | Motif Search (
)
Use the arrows to add or remove sequences or sequence lists from the selected elements.
You can perform the analysis on several DNA or several protein sequences at a time. If the
analysis is performed on several sequences at a time the method will search for patterns in the
sequences and create an overview table of the motifs found in all sequences.
Click Next to adjust parameters (see figure 14.26).
Figure 14.26: Setting parameters for the motif search.
The options for the motif search are:
• Motif types. Choose what kind of motif to be used:
Simple motif. Choosing this option means that you enter a simple motif, e.g.
ATGATGNNATG.
Java regular expression. See section 14.7.3.
Prosite regular expression. For proteins, you can enter different protein patterns from
the PROSITE database (protein patterns using regular expressions and describing
specific amino acid sequences). The PROSITE database contains a great number of
patterns and have been used to identify related proteins (see http://www.expasy.
org/cgi-bin/prosite-list.pl).
CHAPTER 14. GENERAL SEQUENCE ANALYSES
Use motif list. Clicking the small button (
(see section 14.7.4).
221
) will allow you to select a saved motif list
• Motif. If you choose to search with a simple motif, you should enter a literal string as your
motif. Ambiguous amino acids and nucleotides are allowed. Example; ATGATGNNATG. If
your motif type is Java regular expression, you should enter a regular expression according
to the syntax rules described in section 14.7.3. Press Shift + F1 key for options. For
proteins, you can search with a Prosite regular expression and you should enter a protein
pattern from the PROSITE database.
• Accuracy. If you search with a simple motif, you can adjust the accuracy of the motif to the
match on the sequence. If you type in a simple motif and let the accuracy be 80%, the motif
search algorithm runs through the input sequence and finds all subsequences of the same
length as the simple motif such that the fraction of identity between the subsequence and
the simple motif is at least 80%. A motif match is added to the sequence as an annotation
with the exact fraction of identity between the subsequence and the simple motif. If you
use a list of motifs, the accuracy applies only to the simple motifs in the list.
• Search for reverse motif. This enables searching on the negative strand on nucleotide
sequences.
• Exclude unknown regions. Genome sequence often have large regions with unknown
sequence. These regions are very often padded with N's. Ticking this checkbox will not
display hits found in N-regions.Motif search handles ambiguous characters in the way that
two residues are different if they do not have any residues in common. For example: For
nucleotides, N matches any character and R matches A,G. For proteins, X matches any
character and Z matches E,Q.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
There are two types of results that can be produced:
• Add annotations. This will add an annotation to the sequence when a motif is found (an
example is shown in figure 14.27.
• Create table. This will create an overview table of all the motifs found for all the input
sequences.
Figure 14.27: Sequence view displaying the pattern found. The search string was 'tataaa'.
14.7.3
Java regular expressions
A regular expressions is a string that describes or matches a set of strings, according to
certain syntax rules. They are usually used to give a concise description of a set, without
CHAPTER 14. GENERAL SEQUENCE ANALYSES
222
having to list all elements. The simplest form of a regular expression is a literal string. The
syntax used for the regular expressions is the Java regular expression syntax (see http:
//java.sun.com/docs/books/tutorial/essential/regex/index.html). Below is
listed some of the most important syntax rules which are also shown in the help pop-up when
you press Shift + F1:
[A-Z] will match the characters A through Z (Range). You can also put single characters
between the brackets: The expression [AGT] matches the characters A, G or T.
[A-D[M-P]] will match the characters A through D and M through P (Union). You can also put
single characters between the brackets: The expression [AG[M-P]] matches the characters
A, G and M through P.
[A-M&&[H-P]] will match the characters between A and M lying between H and P (Intersection).
You can also put single characters between the brackets. The expression [A-M&&[HGTDA]]
matches the characters A through M which is H, G, T, D or A.
[ A-M] will match any character except those between A and M (Excluding). You can also
put single characters between the brackets: The expression [ AG] matches any character
except A and G.
[A-Z&&[ M-P]] will match any character A through Z except those between M and P
(Subtraction). You can also put single characters between the brackets: The expression
[A-P&&[ CG]] matches any character between A and P except C and G.
The symbol . matches any character.
X{n} will match a repetition of an element indicated by following that element with a
numerical value or a numerical range between the curly brackets. For example, ACG{2}
matches the string ACGG and (ACG){2} matches ACGACG.
X{n,m} will match a certain number of repetitions of an element indicated by following that
element with two numerical values between the curly brackets. The first number is a lower
limit on the number of repetitions and the second number is an upper limit on the number
of repetitions. For example, ACT{1,3} matches ACT, ACTT and ACTTT.
X{n,} represents a repetition of an element at least n times. For example, (AC){2,} matches
all strings ACAC, ACACAC, ACACACAC,...
The symbol restricts the search to the beginning of your sequence. For example, if you
search through a sequence with the regular expression AC, the algorithm will find a match
if AC occurs in the beginning of the sequence.
The symbol $ restricts the search to the end of your sequence. For example, if you search
through a sequence with the regular expression GT$, the algorithm will find a match if GT
occurs in the end of the sequence.
Examples
The expression [ACG][ AC]G{2} matches all strings of length 4, where the first character is A,C
or G and the second is any character except A,C and the third and fourth character is G. The
expression G.[ A]$ matches all strings of length 3 in the end of your sequence, where the first
character is C, the second any character and the third any character except A.
CHAPTER 14. GENERAL SEQUENCE ANALYSES
14.7.4
223
Create motif list
CLC Protein Workbench offers advanced and versatile options to create lists of sequence patterns
or known motifs represented either by a literal string or a regular expression.
A motif list is created from the Toolbox:
Toolbox | General Sequence Analyses | Create Motif List (
)
This will open an empty list where you can add motifs by clicking the Add (
bottom of the view. This will open a dialog shown in figure 14.28.
) button at the
Figure 14.28: Entering a new motif in the list.
In this dialog, you can enter the following information:
• Name. The name of the motif. In the result of a motif search, this name will appear as the
name of the annotation and in the result table.
• Motif. The actual motif. See section 14.7.2 for more information about the syntax of
motifs.
• Description. You can enter a description of the motif. In the result of a motif search,
the description will appear in the result table and added as a note to the annotation on
the sequence (visible in the Annotation table ( ) or by placing the mouse cursor on the
annotation).
• Type. You can enter three different types of motifs: Simple motifs, java regular expressions
or PROSITE regular expression. Read more in section 14.7.2.
The motif list can contain a mix of different types of motifs. This is practical because some
motifs can be described with the simple syntax, whereas others need the more advanced regular
expression syntax.
Instead of manually adding motifs, you can Import From Fasta File ( ). This will show a dialog
where you can select a fasta file on your computer and use this to create motifs. This will
automatically take the name, description and sequence information from the fasta file, and put
it into the motif list. The motif type will be "simple".
CHAPTER 14. GENERAL SEQUENCE ANALYSES
224
Besides adding new motifs, you can also edit and delete existing motifs in the list. To edit a
motif, either double-click the motif in the list, or select and click the Edit ( ) button at the
bottom of the view.
To delete a motif, select it and press the Delete key on the keyboard. Alternatively, click Delete
( ) in the Tool bar.
Save the motif list in the Navigation Area, and you will be able to use for Motif Search (
section 14.7).
) (see
Chapter 15
Nucleotide analyses
Contents
15.1 Convert DNA to RNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 225
15.2 Convert RNA to DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 226
15.3 Reverse complements of sequences . . . . . . . . . . . . . . . . . . . . . . . 227
15.4 Reverse sequence . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 228
15.5 Translation of DNA or RNA to protein . . . . . . . . . . . . . . . . . . . . . . 228
15.5.1
Translate part of a nucleotide sequence . . . . . . . . . . . . . . . . . . 230
15.6 Find open reading frames . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 230
15.6.1
Open reading frame parameters . . . . . . . . . . . . . . . . . . . . . . 230
CLC Protein Workbench offers different kinds of sequence analyses, which only apply to DNA and
RNA.
15.1
Convert DNA to RNA
CLC Protein Workbench lets you convert a DNA sequence into RNA, substituting the T residues
(Thymine) for U residues (Urasil):
select a DNA sequence in the Navigation Area | Toolbox in the Menu Bar | Nucleotide
Analyses ( ) | Convert DNA to RNA ( )
or right-click a sequence in Navigation Area | Toolbox | Nucleotide Analyses (
Convert DNA to RNA ( )
)|
This opens the dialog displayed in figure 15.1:
If a sequence was selected before choosing the Toolbox action, this sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
Note! You can select multiple DNA sequences and sequence lists at a time. If the sequence list
contains RNA sequences as well, they will not be converted.
225
CHAPTER 15. NUCLEOTIDE ANALYSES
226
Figure 15.1: Translating DNA to RNA.
15.2
Convert RNA to DNA
CLC Protein Workbench lets you convert an RNA sequence into DNA, substituting the U residues
(Urasil) for T residues (Thymine):
select an RNA sequence in the Navigation Area | Toolbox in the Menu Bar |
Nucleotide Analyses ( ) | Convert RNA to DNA ( )
or right-click a sequence in Navigation Area | Toolbox | Nucleotide Analyses (
Convert RNA to DNA ( )
)|
This opens the dialog displayed in figure 15.2:
Figure 15.2: Translating RNA to DNA.
If a sequence was selected before choosing the Toolbox action, this sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
This will open a new view in the View Area displaying the new DNA sequence. The new sequence
is not saved automatically. To save the sequence, drag it into the Navigation Area or press Ctrl
CHAPTER 15. NUCLEOTIDE ANALYSES
+S(
227
+ S on Mac) to activate a save dialog.
Note! You can select multiple RNA sequences and sequence lists at a time. If the sequence list
contains DNA sequences as well, they will not be converted.
15.3
Reverse complements of sequences
CLC Protein Workbench is able to create the reverse complement of a nucleotide sequence. By
doing that, a new sequence is created which also has all the annotations reversed since they
now occupy the opposite strand of their previous location.
To quickly obtain the reverse complement of a sequence or part of a sequence, you may select
a region on the negative strand and open it in a new view:
right-click a selection on the negative strand | Open selection in New View (
)
By doing that, the sequence will be reversed. This is only possible when the double stranded
view option is enabled. It is possible to copy the selection and paste it in a word processing
program or an e-mail. To obtain a reverse complement of an entire sequence:
select a sequence in the Navigation Area | Toolbox in the Menu Bar | Nucleotide
Analyses ( ) | Reverse Complement ( )
or right-click a sequence in Navigation Area | Toolbox | Nucleotide Analyses (
Reverse Complement ( )
)|
This opens the dialog displayed in figure 15.3:
Figure 15.3: Creating a reverse complement sequence.
If a sequence was selected before choosing the Toolbox action, the sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
This will open a new view in the View Area displaying the reverse complement of the selected
sequence. The new sequence is not saved automatically. To save the sequence, drag it into the
Navigation Area or press Ctrl + S ( + S on Mac) to activate a save dialog.
CHAPTER 15. NUCLEOTIDE ANALYSES
15.4
228
Reverse sequence
CLC Protein Workbench is able to create the reverse of a nucleotide sequence. By doing that, a
new sequence is created which also has all the annotations reversed since they now occupy the
opposite strand of their previous location.
Note! This is not the same as a reverse complement. If you wish to create the reverse
complement, please refer to section 15.3.
select a sequence in the Navigation Area | Toolbox in the Menu Bar | Nucleotide
Analyses ( ) | Reverse Sequence ( )
This opens the dialog displayed in figure 15.4:
Figure 15.4: Reversing a sequence.
If a sequence was selected before choosing the Toolbox action, the sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
Note! This is not the same as a reverse complement. If you wish to create the reverse
complement, please refer to section 15.3.
15.5
Translation of DNA or RNA to protein
In CLC Protein Workbench you can translate a nucleotide sequence into a protein sequence using
the Toolbox tools. Usually, you use the +1 reading frame which means that the translation
starts from the first nucleotide. Stop codons result in an asterisk being inserted in the protein
sequence at the corresponding position. It is possible to translate in any combination of the six
reading frames in one analysis. To translate:
select a nucleotide sequence | Toolbox in the Menu Bar | Nucleotide Analyses (
| Translate to Protein ( )
or right-click a nucleotide sequence | Toolbox | Nucleotide Analyses (
to Protein ( )
)
) | Translate
CHAPTER 15. NUCLEOTIDE ANALYSES
229
This opens the dialog displayed in figure 15.5:
Figure 15.5: Choosing sequences for translation.
If a sequence was selected before choosing the Toolbox action, the sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
Clicking Next generates the dialog seen in figure 15.6:
Figure 15.6: Choosing +1 and +3 reading frames, and the standard translation table.
Here you have the following options:
Reading frames If you wish to translate the whole sequence, you must specify the reading frame
for the translation. If you select e.g. two reading frames, two protein sequences are
generated.
Translate coding regions You can choose to translate regions marked by and CDS or ORF
annotation. This will generate a protein sequence for each CDS or ORF annotation on the
sequence.
Genetic code translation table Lets you specify the genetic code for the translation.
The
translation tables are occasionally updated from NCBI. The tables are not available in this
CHAPTER 15. NUCLEOTIDE ANALYSES
230
printable version of the user manual. Instead, the tables are included in the Help-menu in
the Menu Bar (in the appendix).
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
The newly created protein is shown, but is not saved automatically.
To save a protein sequence, drag it into the Navigation Area or press Ctrl + S (
activate a save dialog.
15.5.1
+ S on Mac) to
Translate part of a nucleotide sequence
If you want to make separate translations of all the coding regions of a nucleotide sequence, you
can check the option: "Translate CDS and ORF" in the translation dialog (see figure 15.6).
If you want to translate a specific coding region, which is annotated on the sequence, use the
following procedure:
Open the nucleotide sequence | right-click the ORF or CDS annotation | Translate
CDS/ORF ( ) | choose a translation table | OK
If the annotation contains information about the translation, this information will be used, and
you do not have to specify a translation table.
The CDS and ORF annotations are colored yellow as default.
15.6
Find open reading frames
The CLC Protein Workbench Find Open Reading Frames function can be used to find all open
reading frames (ORF) in a sequence, or, by choosing particular start codons to use, it can be used
as a rudimentary gene finder. ORFs identified will be shown as annotations on the sequence. You
have the option of choosing a translation table, the start codons to use, minimum ORF length as
well as a few other parameters. These choices are explained in this section.
To find open reading frames:
select a nucleotide sequence | Toolbox in the Menu Bar | Nucleotide Analyses (
| Find Open Reading Frames ( )
or right-click a nucleotide sequence | Toolbox | Nucleotide Analyses (
Reading Frames ( )
)
) | Find Open
This opens the dialog displayed in figure 15.7:
If a sequence was selected before choosing the Toolbox action, the sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
If you want to adjust the parameters for finding open reading frames click Next.
15.6.1
Open reading frame parameters
This opens the dialog displayed in figure 15.8:
The adjustable parameters for the search are:
CHAPTER 15. NUCLEOTIDE ANALYSES
231
Figure 15.7: Create Reading Frame dialog.
Figure 15.8: Create Reading Frame dialog.
• Start codon:
AUG. Most commonly used start codon.
Any. Find all open reading frames.
All start codons in genetic code.
Other. Here you can specify a number of start codons separated by commas.
• Both strands. Finds reading frames on both strands.
• Open-ended Sequence. Allows the ORF to start or end outside the sequence. If the
sequence studied is a part of a larger sequence, it may be advantageous to allow the ORF
to start or end outside the sequence.
• Genetic code translation table.
• Include stop codon in result The ORFs will be shown as annotations which can include the
stop codon if this option is checked. The translation tables are occasionally updated from
NCBI. The tables are not available in this printable version of the user manual. Instead, the
tables are included in the Help-menu in the Menu Bar (in the appendix).
CHAPTER 15. NUCLEOTIDE ANALYSES
232
• Minimum Length. Specifies the minimum length for the ORFs to be found. The length is
specified as number of codons.
Using open reading frames for gene finding is a fairly simple approach which is likely to predict
genes which are not real. Setting a relatively high minimum length of the ORFs will reduce the
number of false positive predictions, but at the same time short genes may be missed (see
figure 15.9).
Figure 15.9: The first 12,000 positions of the E. coli sequence NC_000913 downloaded from
GenBank. The blue (dark) annotations are the genes while the yellow (brighter) annotations are the
ORFs with a length of at least 100 amino acids. On the positive strand around position 11,000,
a gene starts before the ORF. This is due to the use of the standard genetic code rather than the
bacterial code. This particular gene starts with CTG, which is a start codon in bacteria. Two short
genes are entirely missing, while a handful of open reading frames do not correspond to any of the
annotated genes.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
Finding open reading frames is often a good first step in annotating sequences such as cloning
vectors or bacterial genomes. For eukaryotic genes, ORF determination may not always be very
helpful since the intron/exon structure is not part of the algorithm.
Chapter 16
Protein analyses
Contents
16.1 Signal peptide prediction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 234
16.1.1
Signal peptide prediction parameter settings
. . . . . . . . . . . . . . . 234
16.1.2
Signal peptide prediction output . . . . . . . . . . . . . . . . . . . . . . 235
16.1.3
Bioinformatics explained: Prediction of signal peptides . . . . . . . . . . 235
16.2 Protein charge . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 240
16.2.1
Modifying the layout . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 241
16.3 Transmembrane helix prediction . . . . . . . . . . . . . . . . . . . . . . . . . 241
16.4 Antigenicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 242
16.4.1
Plot of antigenicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 243
16.4.2
Antigenicity graphs along sequence
. . . . . . . . . . . . . . . . . . . . 244
16.5 Hydrophobicity . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 244
16.5.1
Hydrophobicity plot . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 245
16.5.2
16.5.3
Hydrophobicity graphs along sequence . . . . . . . . . . . . . . . . . . . 246
Bioinformatics explained: Protein hydrophobicity . . . . . . . . . . . . . . 247
16.6 Pfam domain search
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 249
16.6.1
Pfam search parameters . . . . . . . . . . . . . . . . . . . . . . . . . . 250
16.6.2
Download and installation of additional Pfam databases . . . . . . . . . 251
16.7 Secondary structure prediction . . . . . . . . . . . . . . . . . . . . . . . . . . 251
16.8 Protein report . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 253
16.8.1
Protein report output
. . . . . . . . . . . . . . . . . . . . . . . . . . . . 254
16.9 Reverse translation from protein into DNA
. . . . . . . . . . . . . . . . . . . 255
16.9.1
Reverse translation parameters . . . . . . . . . . . . . . . . . . . . . . . 256
16.9.2
Bioinformatics explained: Reverse translation . . . . . . . . . . . . . . . 257
16.10 Proteolytic cleavage detection . . . . . . . . . . . . . . . . . . . . . . . . . . 259
16.10.1 Proteolytic cleavage parameters . . . . . . . . . . . . . . . . . . . . . . 259
16.10.2 Bioinformatics explained: Proteolytic cleavage . . . . . . . . . . . . . . . 262
CLC Protein Workbench offers a number of analyses of proteins as described in this chapter.
233
CHAPTER 16. PROTEIN ANALYSES
16.1
234
Signal peptide prediction
Signal peptides target proteins to the extracellular environment either through direct plasmamembrane translocation in prokaryotes or is routed through the Endoplasmatic Reticulum in
eukaryotic cells. The signal peptide is removed from the resulting mature protein during translocation across the membrane. For prediction of signal peptides, we query SignalP [Nielsen et al.,
1997, Bendtsen et al., 2004b] located at http://www.cbs.dtu.dk/services/SignalP/.
Thus an active internet connection is required to run the signal peptide prediction. Additional
information on SignalP and Center for Biological Sequence analysis (CBS) can be found at
http://www.cbs.dtu.dk and in the original research papers [Nielsen et al., 1997, Bendtsen
et al., 2004b].
In order to predict potential signal peptides of proteins, the D-score from the SignalP output is
used for discrimination of signal peptide versus non-signal peptide (see section 16.1.3). This
score has been shown to be the most accurate [Klee and Ellis, 2005] in an evaluation study of
signal peptide predictors.
In order to use SignalP, you need to download the SignalP plug-in using the plug-in manager, see
section 1.7.1.
When the plug-in is downloaded and installed, you can use it to predict signal peptides:
Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses (
Signal Peptide Prediction ( )
or right-click a protein sequence | Toolbox | Protein Analyses (
Prediction ( )
) |
) | Signal Peptide
If a sequence was selected before choosing the Toolbox action, this sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
Click Next to set parameters for the SignalP analysis.
16.1.1
Signal peptide prediction parameter settings
It is possible to set different options prior to running the analysis (see figure 16.1). An organism
type should be selected. The default is eukaryote.
• Eukaryote (default)
• Gram-negative bacteria
• Gram-positive bacteria
You can perform the analysis on several protein sequences at a time. This will add annotations
to all the sequences and open a view for each sequence if a signal peptide is found. If no signal
peptide is found in the sequence a dialog box will be shown.
The predictions obtained can either be shown as annotations on the sequence, listed in a table
or be shown as the detailed and full text output from the SignalP method. This can be used to
interpret borderline predictions:
• Add annotations to sequence
CHAPTER 16. PROTEIN ANALYSES
235
Figure 16.1: Setting the parameters for signal peptide prediction.
• Create table
• Text
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
16.1.2
Signal peptide prediction output
After running the prediction as described above, the protein sequence will show predicted signal
peptide as annotations on the original sequence (see figure 16.2).
Figure 16.2: N-terminal signal peptide shown as annotation on the sequence.
Each annotation will carry a tooltip note saying that the corresponding annotation is predicted with
SignalP version 3.0. Additional notes can be added through the Edit annotation ( ) right-click
mouse menu. See section 10.3.2.
Undesired annotations can be removed through the Delete Annotation (
menu. See section 10.3.4.
16.1.3
) right-click mouse
Bioinformatics explained: Prediction of signal peptides
Why the interest in signal peptides?
The importance of signal peptides was shown in 1999 when Günter Blobel received the Nobel
Prize in physiology or medicine for his discovery that "proteins have intrinsic signals that govern
CHAPTER 16. PROTEIN ANALYSES
236
their transport and localization in the cell" [Blobel, 2000]. He pointed out the importance of
defined peptide motifs for targeting proteins to their site of function.
Performing a query to PubMed1 reveals that thousands of papers have been published, regarding
signal peptides, secretion and subcellular localization, including knowledge of using signal
peptides as vehicles for chimeric proteins for biomedical and pharmaceutical industry. Many
papers describe statistical or machine learning methods for prediction of signal peptides and
prediction of subcellular localization in general. After the first published method for signal peptide
prediction [von Heijne, 1986], more and more methods have surfaced, although not all methods
have been made available publicly.
Different types of signal peptides
Soon after Günter Blobel's initial discovery of signal peptides, more targeting signals were found.
Most cell types and organisms employ several ways of targeting proteins to the extracellular
environment or subcellular locations. Most of the proteins targeted for the extracellular space or
subcellular locations carry specific sequence motifs (signal peptides) characterizing the type of
secretion/targeting it undergoes.
Several new different signal peptides or targeting signals have been found during the later years,
and papers often describe a small amino acid motif required for secretion of that particular
protein. In most of the latter cases, the identified sequence motif is only found in this particular
protein and as such cannot be described as a new group of signal peptides.
Describing the various types of signal peptides is beyond the scope of this text but several review
papers on this topic can be found on PubMed. Targeting motifs can either be removed from, or
retained in the mature protein after the protein has reached the correct and final destination.
Some of the best characterized signal peptides are depicted in figure 16.3.
Numerous methods for prediction of protein targeting and signal peptides have been developed;
some of them are mentioned and cited in the introduction of the SignalP research paper [Bendtsen
et al., 2004b]. However, no prediction method will be able to cover all the different types of signal
peptides. Most methods predicts classical signal peptides targeting to the general secretory
pathway in bacteria or classical secretory pathway in eukaryotes. Furthermore, a few methods for
prediction of non-classically secreted proteins have emerged [Bendtsen et al., 2004a, Bendtsen
et al., 2005].
Prediction of signal peptides and subcellular localization
In the search for accurate prediction of signal peptides, many approaches have been investigated.
Almost 20 years ago, the first method for prediction of classical signal peptides was published [von
Heijne, 1986]. Nowadays, more sophisticated machine learning methods, such as neural
networks, support vector machines, and hidden Markov models have arrived along with the
increasing computational power and they all perform superior to the old weight matrix based
methods [Menne et al., 2000]. Also, many other "classical" statistical approaches have been
carried out, often in conjunction with machine learning methods. In the following sections, a wide
range of different signal peptide and subcellular prediction methods will be described.
Most signal peptide prediction methods require the presence of the correct N-terminal end of
1
http://www.ncbi.nlm.nih.gov/entrez/
CHAPTER 16. PROTEIN ANALYSES
237
Figure 16.3: Schematic representation of various signal peptides. Red color indicates n-region, gray
color indicates h-region, cyan indicates c-region. All white circles are part of the mature protein. +1
indicates the first position of the mature protein. The length of the signal peptides is not drawn to
scale.
the preprotein for correct classification. As large scale genome sequencing projects sometimes
assign the 5'-end of genes incorrectly, many proteins are annotated without the correct Nterminal [Reinhardt and Hubbard, 1998] leading to incorrect prediction of subcellular localization.
These erroneous predictions can be ascribed directly to poor gene finding. Other methods for
prediction of subcellular localization use information within the mature protein and therefore they
are more robust to N-terminal truncation and gene finding errors.
CHAPTER 16. PROTEIN ANALYSES
238
Figure 16.4: Sequence logo of eukaryotic signal peptides, showing conservation of amino acids
in bits [Schneider and Stephens, 1990]. Polar and hydrophobic residues are shown in green and
black, respectively, while blue indicates positively charged residues and red negatively charged
residues. The logo is based on an ungapped sequence alignment fixed at the -1 position of the
signal peptides.
The SignalP method
One of the most cited and best methods for prediction of classical signal peptides is the SignalP
method [Nielsen et al., 1997, Bendtsen et al., 2004b]. In contrast to other methods, SignalP
also predicts the actual cleavage site; thus the peptide which is cleaved off during translocation
over the membrane. Recently, an independent research paper has rated SignalP version 3.0
to be the best standalone tool for signal peptide prediction. It was shown that the D-score
which is reported by the SignalP method is the best measure for discriminating secretory from
non-secretory proteins [Klee and Ellis, 2005].
SignalP is located at http://www.cbs.dtu.dk/services/SignalP/
What do the SignalP scores mean?
Many bioinformatics approaches or prediction tools do not give a yes/no answer. Often the user
is facing an interpretation of the output, which can be either numerical or graphical. Why is that?
In clear-cut examples there are no doubt; yes: this is a signal peptide! But, in borderline cases it
is often convenient to have more information than just a yes/no answer. Here a graphical output
can aid to interpret the correct answer. An example is shown in figure 16.5.
The graphical output from SignalP (neural network) comprises three different scores, C, S and
Y. Two additional scores are reported in the SignalP3-NN output, namely the S-mean and the
D-score, but these are only reported as numerical values.
For each organism class in SignalP; Eukaryote, Gram-negative and Gram-positive, two different
neural networks are used, one for predicting the actual signal peptide and one for predicting
the position of the signal peptidase I (SPase I) cleavage site. The S-score for the signal peptide
prediction is reported for every single amino acid position in the submitted sequence, with high
scores indicating that the corresponding amino acid is part of a signal peptide, and low scores
indicating that the amino acid is part of a mature protein.
CHAPTER 16. PROTEIN ANALYSES
239
Figure 16.5: Graphical output from the SignalP method of Swiss-Prot entry SFMA_ECOLI. Initially
this seemed like a borderline prediction, but closer inspection of the sequence revealed an internal
methionine at position 12, which could indicate a erroneously annotated start of the protein. Later
this protein was re-annotated by Swiss-Prot to start at the M in position 12. See the text for
description of the scores.
The C-score is the "cleavage site" score. For each position in the submitted sequence, a C-score
is reported, which should only be significantly high at the cleavage site. Confusion is often seen
with the position numbering of the cleavage site. When a cleavage site position is referred to by
a single number, the number indicates the first residue in the mature protein. This means that a
reported cleavage site between amino acid 26-27 corresponds to the mature protein starting at
(and include) position 27.
Y-max is a derivative of the C-score combined with the S-score resulting in a better cleavage site
prediction than the raw C-score alone. This is due to the fact that multiple high-peaking C-scores
can be found in one sequence, where only one is the true cleavage site. The cleavage site is
assigned from the Y-score where the slope of the S-score is steep and a significant C-score is
found.
The S-mean is the average of the S-score, ranging from the N-terminal amino acid to the amino
acid assigned with the highest Y-max score, thus the S-mean score is calculated for the length of
the predicted signal peptide. The S-mean score was in SignalP version 2.0 used as the criteria
for discrimination of secretory and non-secretory proteins.
The D-score is introduced in SignalP version 3.0 and is a simple average of the S-mean and Y-max
score. The score shows superior discrimination performance of secretory and non-secretory
proteins to that of the S-mean score which was used in SignalP version 1 and 2.
For non-secretory proteins all the scores represented in the SignalP3-NN output should ideally be
very low.
The hidden Markov model calculates the probability of whether the submitted sequence contains
a signal peptide or not. The eukaryotic HMM model also reports the probability of a signal
anchor, previously named uncleaved signal peptides. Furthermore, the cleavage site is assigned
by a probability score together with scores for the n-region, h-region, and c-region of the signal
peptide, if it is found.
Other useful resources
http://www.cbs.dtu.dk/services/SignalP
Pubmed entries for some of the original papers.
CHAPTER 16. PROTEIN ANALYSES
240
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Retrieve&dopt=
AbstractPlus&list_uids=9051728&query_hl=1&itool=pubmed_docsum
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_
uids=15223320&dopt=Citation
Creative Commons License
All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational
purposes, under the following conditions: You must attribute the work in its original form and
"CLC bio" has to be clearly labeled as author and provider of the work. You may not use this
work for commercial purposes. You may not alter, transform, nor build upon this work.
See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on
how to use the contents.
16.2
Protein charge
In CLC Protein Workbench you can create a graph in the electric charge of a protein as a
function of pH. This is particularly useful for finding the net charge of the protein at a given pH.
This knowledge can be used e.g. in relation to isoelectric focusing on the first dimension of
2D-gel electrophoresis. The isoelectric point (pI) is found where the net charge of the protein
is zero. The calculation of the protein charge does not include knowledge about any potential
post-translational modifications the protein may have.
The pKa values reported in the literature may differ slightly, thus resulting in different looking
graphs of the protein charge plot compared to other programs.
In order to calculate the protein charge:
Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses (
Create Protein Charge Plot ( )
or right-click a protein sequence | Toolbox | Protein Analyses (
Charge Plot ( )
) |
) | Create Protein
This opens the dialog displayed in figure 16.6:
If a sequence was selected before choosing the Toolbox action, the sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
You can perform the analysis on several protein sequences at a time. This will result in one
output graph showing protein charge graphs for the individual proteins.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
CHAPTER 16. PROTEIN ANALYSES
241
Figure 16.6: Choosing protein sequences to calculate protein charge.
16.2.1
Modifying the layout
Figure 16.7 shows the electrical charges for three proteins. In the Side Panel to the right, you
can modify the layout of the graph.
Figure 16.7: View of the protein charge.
See section B in the appendix for information about the graph view.
16.3
Transmembrane helix prediction
Many proteins are integral membrane proteins. Most membrane proteins have hydrophobic
regions which span the hydrophobic core of the membrane bi-layer and hydrophilic regions
located on the outside or the inside of the membrane. Many receptor proteins have several
transmembrane helices spanning the cellular membrane.
For prediction of transmembrane helices, CLC Protein Workbench uses TMHMM version 2.0
[Krogh et al., 2001] located at http://www.cbs.dtu.dk/services/TMHMM/, thus an
active internet connection is required to run the transmembrane helix prediction. Additional
information on THMHH and Center for Biological Sequence analysis (CBS) can be found at
CHAPTER 16. PROTEIN ANALYSES
242
http://www.cbs.dtu.dk and in the original research paper [Krogh et al., 2001].
In order to use the transmembrane helix prediction, you need to download the plug-in using the
plug-in manager (see section 1.7.1).
When the plug-in is downloaded and installed, you can use it to predict transmembrane helices:
Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses (
Transmembrane Helix Prediction ( )
or right-click a protein sequence | Toolbox | Protein Analyses (
Helix Prediction ( )
) |
) | Transmembrane
If a sequence was selected before choosing the Toolbox action, this sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
The predictions obtained can either be shown as annotations on the sequence, in a table or as
the detailed and text output from the TMHMM method.
• Add annotations to sequence
• Create table
• Text
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
You can perform the analysis on several protein sequences at a time. This will add annotations
to all the sequences and open a view for each sequence if a transmembrane helix is found. If a
transmembrane helix is not found a dialog box will be presented.
After running the prediction as described above, the protein sequence will show predicted
transmembrane helices as annotations on the original sequence (see figure 16.8). Moreover,
annotations showing the topology will be shown. That is, which part the proteins is located on
the inside or on the outside.
Each annotation will carry a tooltip note saying that the corresponding annotation is predicted with
TMHMM version 2.0. Additional notes can be added through the Edit annotation ( ) right-click
mouse menu. See section 10.3.2.
Undesired annotations can be removed through the Delete Annotation (
menu. See section 10.3.4.
16.4
) right-click mouse
Antigenicity
CLC Protein Workbench can help to identify antigenic regions in protein sequences in different
ways, using different algorithms. The algorithms provided in the Workbench, merely plot an index
of antigenicity over the sequence.
Two different methods are available.
[Welling et al., 1985] Welling et al. used information on the relative occurrence of amino acids in
antigenic regions to make a scale which is useful for prediction of antigenic regions. This method
CHAPTER 16. PROTEIN ANALYSES
243
Figure 16.8: Transmembrane segments shown as annotation on the sequence and the topology.
is better than the Hopp-Woods scale of hydrophobicity which is also used to identify antigenic
regions.
A semi-empirical method for prediction of antigenic regions has been developed [Kolaskar and
Tongaonkar, 1990]. This method also includes information of surface accessibility and flexibility
and at the time of publication the method was able to predict antigenic determinants with an
accuracy of 75%.
Note! Similar results from the two method can not always be expected as the two methods are
based on different training sets.
16.4.1
Plot of antigenicity
Displaying the antigenicity for a protein sequence in a plot is done in the following way:
select a protein sequence in Navigation Area | Toolbox in the Menu Bar | Protein
Analyses ( ) | Create Antigenicity Plot ( )
This opens a dialog. The first step allows you to add or remove sequences. Clicking Next takes
you through to Step 2, which is displayed in figure 16.9.
The Window size is the width of the window where, the antigenicity is calculated. The wider the
window, the less volatile the graph. You can chose from a number of antigenicity scales. Click
Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish. The
result can be seen in figure 16.10.
See section B in the appendix for information about the graph view.
The level of antigenicity is calculated on the basis of the different scales. The different scales
add different values to each type of amino acid. The antigenicity score is then calculated as the
CHAPTER 16. PROTEIN ANALYSES
244
Figure 16.9: Step two in the Antigenicity Plot allows you to choose different antigenicity scales and
the window size.
Figure 16.10: The result of the antigenicity plot calculation and the associated Side Panel.
sum of the values in a 'window', which is a particular range of the sequence. The window length
can be set from 5 to 25 residues. The wider the window, the less fluctuations in the antigenicity
scores.
16.4.2
Antigenicity graphs along sequence
Antigenicity graphs along the sequence can be displayed using the Side Panel. The functionality
is similar to hydrophobicity (see section 16.5.2).
16.5
Hydrophobicity
CLC Protein Workbench can calculate the hydrophobicity of protein sequences in different ways,
using different algorithms. (See section 16.5.3). Furthermore, hydrophobicity of sequences
can be displayed as hydrophobicity plots and as graphs along sequences. In addition, CLC
Protein Workbench can calculate hydrophobicity for several sequences at the same time, and for
CHAPTER 16. PROTEIN ANALYSES
245
alignments.
16.5.1
Hydrophobicity plot
Displaying the hydrophobicity for a protein sequence in a plot is done in the following way:
select a protein sequence in Navigation Area | Toolbox in the Menu Bar | Protein
Analyses ( ) | Create Hydrophobicity Plot ( )
This opens a dialog. The first step allows you to add or remove sequences. Clicking Next takes
you through to Step 2, which is displayed in figure 16.11.
Figure 16.11: Step two in the Hydrophobicity Plot allows you to choose hydrophobicity scale and
the window size.
The Window size is the width of the window where the hydrophobicity is calculated. The wider
the window, the less volatile the graph. You can chose from a number of hydrophobicity scales
which are further explained in section 16.5.3 Click Next if you wish to adjust how to handle the
results (see section 9.1). If not, click Finish. The result can be seen in figure 16.12.
Figure 16.12: The result of the hydrophobicity plot calculation and the associated Side Panel.
CHAPTER 16. PROTEIN ANALYSES
246
See section B in the appendix for information about the graph view.
16.5.2
Hydrophobicity graphs along sequence
Hydrophobicity graphs along sequence can be displayed easily by activating the calculations from
the Side Panel for a sequence.
right-click protein sequence in Navigation Area | Show | Sequence | open Protein
info in Side Panel
or double-click protein sequence in Navigation Area | Show | Sequence | open Protein
info in Side Panel
These actions result in the view displayed in figure 16.13.
Figure 16.13: The different available scales in Protein info in CLC Protein Workbench.
The level of hydrophobicity is calculated on the basis of the different scales. The different scales
add different values to each type of amino acid. The hydrophobicity score is then calculated as
the sum of the values in a 'window', which is a particular range of the sequence. The window
length can be set from 5 to 25 residues. The wider the window, the less fluctuations in the
hydrophobicity scores. (For more about the theory behind hydrophobicity, see 16.5.3 ).
In the following we will focus on the different ways that CLC Protein Workbench offers to display
the hydrophobicity scores. We use Kyte-Doolittle to explain the display of the scores, but the
different options are the same for all the scales. Initially there are three options for displaying
the hydrophobicity scores. You can choose one, two or all three options by selecting the boxes.
(See figure 16.14).
Figure 16.14: The different ways of displaying the hydrophobicity scores, using the Kyte-Doolittle
scale.
Coloring the letters and their background. When choosing coloring of letters or coloring of
their background, the color red is used to indicate high scores of hydrophobicity. A 'color-slider'
CHAPTER 16. PROTEIN ANALYSES
247
allows you to amplify the scores, thereby emphasizing areas with high (or low, blue) levels of
hydrophobicity. The color settings mentioned are default settings. By clicking the color bar just
below the color slider you get the option of changing color settings.
Graphs along sequences. When selecting graphs, you choose to display the hydrophobicity
scores underneath the sequence. This can be done either by a line-plot or bar-plot, or by coloring.
The latter option offers you the same possibilities of amplifying the scores as applies for coloring
of letters. The different ways to display the scores when choosing 'graphs' are displayed in
figure 16.14. Notice that you can choose the height of the graphs underneath the sequence.
16.5.3
Bioinformatics explained: Protein hydrophobicity
Calculation of hydrophobicity is important to the identification of various protein features. This
can be membrane spanning regions, antigenic sites, exposed loops or buried residues. Usually,
these calculations are shown as a plot along the protein sequence, making it easy to identify the
location of potential protein features.
Figure 16.15: Plot of hydrophobicity along the amino acid sequence. Hydrophobic regions on
the sequence have higher numbers according to the graph below the sequence, furthermore
hydrophobic regions are colored on the sequence. Red indicates regions with high hydrophobicity
and blue indicates regions with low hydrophobicity.
The hydrophobicity is calculated by sliding a fixed size window (of an odd number) over the protein
sequence. At the central position of the window, the average hydrophobicity of the entire window
is plotted (see figure 16.15).
Hydrophobicity scales
Several hydrophobicity scales have been published for various uses. Many of the commonly used
hydrophobicity scales are described below.
Kyte-Doolittle scale. The Kyte-Doolittle scale is widely used for detecting hydrophobic regions in
proteins. Regions with a positive value are hydrophobic. This scale can be used for identifying
both surface-exposed regions as well as transmembrane regions, depending on the window size
used. Short window sizes of 5-7 generally work well for predicting putative surface-exposed
regions. Large window sizes of 19-21 are well suited for finding transmembrane domains if the
values calculated are above 1.6 [Kyte and Doolittle, 1982]. These values should be used as a
rule of thumb and deviations from the rule may occur.
Engelman scale. The Engelman hydrophobicity scale, also known as the GES-scale, is another
scale which can be used for prediction of protein hydrophobicity [Engelman et al., 1986]. As the
Kyte-Doolittle scale, this scale is useful for predicting transmembrane regions in proteins.
Eisenberg scale. The Eisenberg scale is a normalized consensus hydrophobicity scale which
CHAPTER 16. PROTEIN ANALYSES
248
shares many features with the other hydrophobicity scales [Eisenberg et al., 1984].
Hopp-Woods scale. Hopp and Woods developed their hydrophobicity scale for identification of
potentially antigenic sites in proteins. This scale is basically a hydrophilic index where apolar
residues have been assigned negative values. Antigenic sites are likely to be predicted when
using a window size of 7 [Hopp and Woods, 1983].
Cornette scale. Cornette et al. computed an optimal hydrophobicity scale based on 28 published
scales [Cornette et al., 1987]. This optimized scale is also suitable for prediction of alpha-helices
in proteins.
Rose scale. The hydrophobicity scale by Rose et al. is correlated to the average area of buried
amino acids in globular proteins [Rose et al., 1985]. This results in a scale which is not showing
the helices of a protein, but rather the surface accessibility.
Janin scale. This scale also provides information about the accessible and buried amino acid
residues of globular proteins [Janin, 1979].
Welling scale. Welling et al. used information on the relative occurrence of amino acids in
antigenic regions to make a scale which is useful for prediction of antigenic regions. This method
is better than the Hopp-Woods scale of hydrophobicity which is also used to identify antigenic
regions.
Kolaskar-Tongaonkar. A semi-empirical method for prediction of antigenic regions has been
developed [Kolaskar and Tongaonkar, 1990]. This method also includes information of surface
accessibility and flexibility and at the time of publication the method was able to predict antigenic
determinants with an accuracy of 75%.
Surface Probability. Display of surface probability based on the algorithm by [Emini et al., 1985].
This algorithm has been used to identify antigenic determinants on the surface of proteins.
Chain Flexibility. isplay of backbone chain flexibility based on the algorithm by [Karplus and
Schulz, 1985]. It is known that chain flexibility is an indication of a putative antigenic determinant.
Many more scales have been published throughout the last three decades. Even though more
advanced methods have been developed for prediction of membrane spanning regions, the
simple and very fast calculations are still highly used.
Other useful resources
AAindex: Amino acid index database
http://www.genome.ad.jp/dbget/aaindex.html
Creative Commons License
All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational
purposes, under the following conditions: You must attribute the work in its original form and
"CLC bio" has to be clearly labeled as author and provider of the work. You may not use this
work for commercial purposes. You may not alter, transform, nor build upon this work.
CHAPTER 16. PROTEIN ANALYSES
aa
aa
A
C
D
E
F
G
H
I
K
L
M
N
P
Q
R
S
T
V
W
Y
Alanine
Cysteine
Aspartic acid
Glutamic acid
Phenylalanine
Glycine
Histidine
Isoleucine
Lysine
Leucine
Methionine
Asparagine
Proline
Glutamine
Arginine
Serine
Threonine
Valine
Tryptophan
Tyrosine
KyteDoolittle
1.80
2.50
-3.50
-3.50
2.80
-0.40
-3.20
4.50
-3.90
3.80
1.90
-3.50
-1.60
-3.50
-4.50
-0.80
-0.70
4.20
-0.90
-1.30
HoppWoods
-0.50
-1.00
3.00
3.00
-2.50
0.00
-0.50
-1.80
3.00
-1.80
-1.30
0.20
0.00
0.20
3.00
0.30
-0.40
-1.50
-3.40
-2.30
249
Cornette
Eisenberg
Rose
Janin
0.20
4.10
-3.10
-1.80
4.40
0.00
0.50
4.80
-3.10
5.70
4.20
-0.50
-2.20
-2.80
1.40
-0.50
-1.90
4.70
1.00
3.20
0.62
0.29
-0.90
-0.74
1.19
0.48
-0.40
1.38
-1.50
1.06
0.64
-0.78
0.12
-0.85
-2.53
-0.18
-0.05
1.08
0.81
0.26
0.74
0.91
0.62
0.62
0.88
0.72
0.78
0.88
0.52
0.85
0.85
0.63
0.64
0.62
0.64
0.66
0.70
0.86
0.85
0.76
0.30
0.90
-0.60
-0.70
0.50
0.30
-0.10
0.70
-1.80
0.50
0.40
-0.50
-0.30
-0.70
-1.40
-0.10
-0.20
0.60
0.30
-0.40
Engelman
(GES)
1.60
2.00
-9.20
-8.20
3.70
1.00
-3.00
3.10
-8.80
2.80
3.40
-4.80
-0.20
-4.10
-12.3
0.60
1.20
2.60
1.90
-0.70
Table 16.1: Hydrophobicity scales. This table shows seven different hydrophobicity scales which
are generally used for prediction of e.g. transmembrane regions and antigenicity.
See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on
how to use the contents.
16.6
Pfam domain search
With CLC Protein Workbench you can perform a search for Pfam domains on protein sequences. The Pfam database at http://pfam.sanger.ac.uk/ is a large collection of
multiple sequence alignments that covers approximately 9318 protein domains and protein
families [Bateman et al., 2004]. Based on the individual domain alignments, profile HMMs have
been developed. These profile HMMs can be used to search for domains in unknown sequences.
Many proteins have a unique combination of domains which can be responsible, for instance,
for the catalytic activities of enzymes. Pfam was initially developed to aid the annotation of the
C. elegans genome. Annotating unknown sequences based on pairwise alignment methods by
simply transferring annotation from a known protein to the unknown partner does not take domain
organization into account [Galperin and Koonin, 1998]. An unknown protein may be annotated
wrongly, for instance, as an enzyme if the pairwise alignment only finds a regulatory domain.
Using the Pfam search option in CLC Protein Workbench, you can search for domains in sequence
data which otherwise do not carry any annotation information. The Pfam search option adds
all found domains onto the protein sequence which was used for the search. If domains of no
relevance are found they can easily be removed as described in section 10.3.4. Setting a lower
cutoff value will result in fewer domains.
CHAPTER 16. PROTEIN ANALYSES
250
In CLC Protein Workbench we have implemented our own HMM algorithm for prediction of the
Pfam domains. Thus, we do not use the original HMM implementation,
HMMER http://hmmer.wustl.edu/ for domain prediction. We find the most probable state
path/alignment through each profile HMM by the Viterbi algorithm and based on that we derive a
new null model by averaging over the emission distributions of all M and I states that appear in
the state path (M is a match state and I is an insert state). From that model we now arrive at an
additive correction to the original bit-score, like it is done in the original HMMER algorithm.
In order to conduct the Pfam search:
Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses (
Domain Search ( )
or right-click a protein sequence | Toolbox | Protein Analyses (
Search ( )
) | Pfam
) | Pfam Domain
Figure 16.16: Setting parameters for Pfam domain search.
If a sequence was selected before choosing the Toolbox action, this sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
You can perform the analysis on several protein sequences at a time. This will add annotations
to all the sequences and open a view for each sequence. Click Next to adjust parameters (see
figure 16.16).
16.6.1
Pfam search parameters
• Choose database and search type
When searching for Pfam domains it is possible to choose different databases and specify
the search for full domains or fragments of domains. Only the 100 most frequent domains
are included as default in CLC Protein Workbench. Additional databases can be downloaded
directly from CLC bio's web-site at http://www.clcbio.com/resources.
Search full domains and fragments. This option allows you to search both for full
domain but also for partial domains. This could be the case if a domain extends
beyond the ends of a sequence
Search full domains only. Selecting this option only allows searches for full domains.
CHAPTER 16. PROTEIN ANALYSES
251
Search fragments only. Only partial domains will be found.
Database. Only the 100 most frequent domains are included as default in CLC Protein
Workbench, but additional databases can be downloaded and installed as described
in section 16.6.2.
• Set significance cutoff. The E-value (expectation value) is the number of hits that would be
expected to have a score equal to or better than this value, by chance alone. This means
that a good E-value which gives a confident prediction is much less than 1. E-values around
1 is what is expected by chance. Thus, the lower the E-value, the more specific the search
for domains will be. Only positive numbers are allowed.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
This will open a view showing the found domains as annotations on the original sequence (see
figure 16.17). If you have selected several sequences, a corresponding number of views will be
opened.
Figure 16.17: Domains annotations based on Pfam.
Each found domain will be represented as an annotation of the type Region. More information on
each found domain is available through the tooltip, including detailed information on the identity
score which is the basis for the prediction.
For a more detailed description of the provided scores through the tool tip look at http:
//pfam.sanger.ac.uk/help#tabview=tab5.
16.6.2
Download and installation of additional Pfam databases
Additional databases can be downloaded as a resource using the Plug-in manager (
section 1.7.4).
) (see
If you are not able to download directly from the Plug-in manager,
16.7
Secondary structure prediction
An important issue when trying to understand protein function is to know the actual structure
of the protein. Many questions that are raised by molecular biologists are directly targeted at
protein structure. The alpha-helix forms a coiled rodlike structure whereas a beta-sheet show
an extended sheet-like structure. Some proteins are almost devoid of alpha-helices such as
CHAPTER 16. PROTEIN ANALYSES
252
chymotrypsin (PDB_ID: 1AB9) whereas others like myoglobin (PDB_ID: 101M) have a very high
content of alpha-helices.
With CLC Protein Workbench one can predict the secondary structure of proteins very fast.
Predicted elements are alpha-helix, beta-sheet (same as beta-strand) and other regions.
Based on extracted protein sequences from the protein databank (http://www.rcsb.org/
pdb/) a hidden Makov model (HMM) was trained and evaluated for performance. Machine
learning methods have shown superior when it comes to prediction of secondary structure of
proteins [Rost, 2001]. By far the most common structures are Alpha-helices and beta-sheets
which can be predicted, and predicted structures are automatically added to the query as
annotation which later can be edited.
In order to predict the secondary structure of proteins:
Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses (
Predict secondary structure ( )
or right-click a protein sequence | Toolbox | Protein Analyses (
structure ( )
) |
) | Predict secondary
This opens the dialog displayed in figure 16.18:
Figure 16.18: Choosing one or more protein sequences for secondary structure prediction.
If a sequence was selected before choosing the Toolbox action, this sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
You can perform the analysis on several protein sequences at a time. This will add annotations
to all the sequences and open a view for each sequence.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
After running the prediction as described above, the protein sequence will show predicted
alpha-helices and beta-sheets as annotations on the original sequence (see figure 16.19).
Each annotation will carry a tooltip note saying that the corresponding annotation is predicted
with CLC Protein Workbench. Additional notes can be added through the Edit Annotation ( )
right-click mouse menu. See section 10.3.2.
CHAPTER 16. PROTEIN ANALYSES
253
Figure 16.19: Alpha-helices and beta-strands shown as annotations on the sequence.
Undesired alpha-helices or beta-sheets can be removed through the Delete Annotation (
right-click mouse menu. See section 10.3.4.
16.8
)
Protein report
CLC Protein Workbench is able to produce protein reports, that allow you to easily generate
different kinds of information regarding a protein.
Actually a protein report is a collection of some of the protein analyses which are described
elsewhere in this manual.
To create a protein report do the following:
Right-click protein in Navigation Area | Toolbox | Protein Analyses (
Protein Report ( )
) | Create
This opens dialog Step 1, where you can choose which proteins to create a report for. When the
correct one is chosen, click Next.
In dialog Step 2 you can choose which analyses you want to include in the report. The following
list shows which analyses are available and explains where to find more details.
• Sequence statistics. See section 14.4 for more about this topic.
• Plot of charge as function of pH. See section 16.2 for more about this topic.
• Plot of hydrophobicity. See section 16.5 for more about this topic.
• Plot of local complexity. See section 14.3 for more about this topic.
• Dot plot against self. See section 14.2 for more about this topic.
• Secondary structure prediction. See section 16.7 for more about this topic.
• Pfam domain search. See section 16.6 for more about this topic.
• Local BLAST. See section 12.1.3 for more about this topic.
• NCBI BLAST. See section 12.1.1 for more about this topic.
When you have selected the relevant analyses, click Next. Step 3 to Step 7 (if you select all the
analyses in Step 2) are adjustments of parameters for the different analyses. The parameters
CHAPTER 16. PROTEIN ANALYSES
254
are mentioned briefly in relation to the following steps, and you can turn to the relevant chapters
or sections (mentioned above) to learn more about the significance of the parameters.
In Step 3 you can adjust parameters for sequence statistics:
• Individual Statistics Layout. Comparative is disabled because reports are generated for
one protein at a time.
• Include Background Distribution of Amino Acids. Includes distributions from different
organisms. Background distributions are calculated from UniProt www.uniprot.org
version 6.0, dated September 13 2005.
In Step 4 you can adjust parameters for hydrophobicity plots:
• Window size. Width of window on sequence (odd number).
• Hydrophobicity scales. Lets you choose between different scales.
In Step 5 you can adjust a parameter for complexity plots:
• Window size. Width of window on sequence (must be odd).
In Step 6 you can adjust parameters for dot plots:
• Score model. Different scoring matrices.
• Window size. Width of window on sequence.
In Step 7 you can adjust parameters for BLAST search:
• Program. Lets you choose between different BLAST programs.
• Database. Lets you limit your search to a particular database.
16.8.1
Protein report output
An example of Protein report can be seen in figure 16.20.
By double clicking a graph in the output, this graph is shown in a different view (CLC Protein
Workbench generates another tab). The report output and the new graph views can be saved by
dragging the tab into the Navigation Area.
The content of the tables in the report can be copy/pasted out of the program and e.g. into
Microsoft Excel. To do so:
Select content of table | Right-click the selection | Copy
You can also Export (
) the report in Excel format.
CHAPTER 16. PROTEIN ANALYSES
255
Figure 16.20: A protein report. There is a Table of Contents in the Side Panel that makes it easy to
browse the report.
16.9
Reverse translation from protein into DNA
A protein sequence can be back-translated into DNA using CLC Protein Workbench. Due to
degeneracy of the genetic code every amino acid could translate into several different codons
(only 20 amino acids but 64 different codons). Thus, the program offers a number of choices for
determining which codons should be used. These choices are explained in this section.
In order to make a reverse translation:
Select a protein sequence | Toolbox in the Menu Bar | Protein Analyses (
Reverse Translate ( )
or right-click a protein sequence | Toolbox | Protein Analyses (
( )
) |
) | Reverse translate
This opens the dialog displayed in figure 16.21:
Figure 16.21: Choosing a protein sequence for reverse translation.
CHAPTER 16. PROTEIN ANALYSES
256
If a sequence was selected before choosing the Toolbox action, the sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements. You can translate several protein sequences at a
time.
Click Next to adjust the parameters for the translation.
16.9.1
Reverse translation parameters
Figure 16.22 shows the choices for making the translation.
Figure 16.22: Choosing parameters for the reverse translation.
• Use random codon. This will randomly back-translate an amino acid to a codon without
using the translation tables. Every time you perform the analysis you will get a different
result.
• Use only the most frequent codon. On the basis of the selected translation table, this
parameter/option will assign the codon that occurs most often. When choosing this option,
the results of performing several reverse translations will always be the same, contrary to
the other two options.
• Use codon based on frequency distribution. This option is a mix of the other two options.
The selected translation table is used to attach weights to each codon based on its
frequency. The codons are assigned randomly with a probability given by the weights. A
more frequent codon has a higher probability of being selected. Every time you perform
the analysis, you will get a different result. This option yields a result that is closer to the
translation behavior of the organism (assuming you choose an appropriate codon frequency
table).
• Map annotations to reverse translated sequence. If this checkbox is checked, then all
annotations on the protein sequence will be mapped to the resulting DNA sequence. In the
tooltip on the transferred annotations, there is a note saying that the annotation derives
from the original sequence.
CHAPTER 16. PROTEIN ANALYSES
257
The Codon Frequency Table is used to determine the frequencies of the codons. Select a
frequency table from the list that fits the organism you are working with. A translation table of
an organism is created on the basis of counting all the codons in the coding sequences. Every
codon in a Codon Frequency Table has its own count, frequency (per thousand) and fraction
which are calculated in accordance with the occurrences of the codon in the organism. You can
customize the list of codon frequency tables for your installation, see section I.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
The newly created nucleotide sequence is shown, and if the analysis was performed on several
protein sequences, there will be a corresponding number of views of nucleotide sequences. The
new sequence is not saved automatically. To save the sequence, drag it into the Navigation
Area or press Ctrl + S ( + S on Mac) to show the save dialog.
16.9.2
Bioinformatics explained: Reverse translation
In all living cells containing hereditary material such as DNA, a transcription to mRNA and
subsequent a translation to proteins occur. This is of course simplified but is in general what is
happening in order to have a steady production of proteins needed for the survival of the cell. In
bioinformatics analysis of proteins it is sometimes useful to know the ancestral DNA sequence
in order to find the genomic localization of the gene. Thus, the translation of proteins back to
DNA/RNA is of particular interest, and is called reverse translation or back-translation.
The Genetic Code
In 1968 the Nobel Prize in Medicine was awarded to Robert W. Holley, Har Gobind Khorana and
Marshall W. Nirenberg for their interpretation of the Genetic Code (http://nobelprize.org/
medicine/laureates/1968/). The Genetic Code represents translations of all 64 different
codons into 20 different amino acids. Therefore it is no problem to translate a DNA/RNA
sequence into a specific protein. But due to the degeneracy of the genetic code, several codons
may code for only one specific amino acid. This can be seen in the table below. After the discovery
of the genetic code it has been concluded that different organism (and organelles) have genetic
codes which are different from the "standard genetic code". Moreover, the amino acid alphabet
is no longer limited to 20 amino acids. The 21'st amino acid, selenocysteine, is encoded by an
'UGA' codon which is normally a stop codon. The discrimination of a selenocysteine over a stop
codon is carried out by the translation machinery. Selenocysteines are very rare amino acids.
The table below shows the Standard Genetic Code which is the default translation table.
CHAPTER 16. PROTEIN ANALYSES
258
TTT F Phe
TTC F Phe
TTA L Leu
TTG L Leu i
TCT S Ser
TCC S Ser
TCA S Ser
TCG S Ser
TAT Y Tyr
TAC Y Tyr
TAA * Ter
TAG * Ter
TGT C Cys
TGC C Cys
TGA * Ter
TGG W Trp
CTT L Leu
CTC L Leu
CTA L Leu
CTG L Leu i
CCT P Pro
CCC P Pro
CCA P Pro
CCG P Pro
CAT H His
CAC H His
CAA Q Gln
CAG Q Gln
CGT R Arg
CGC R Arg
CGA R Arg
CGG R Arg
ATT I Ile
ATC I Ile
ATA I Ile
ATG M Met i
ACT T Thr
ACC T Thr
ACA T Thr
ACG T Thr
AAT N Asn
AAC N Asn
AAA K Lys
AAG K Lys
AGT S Ser
AGC S Ser
AGA R Arg
AGG R Arg
GTT V Val
GTC V Val
GTA V Val
GTG V Val
GCT A Ala
GCC A Ala
GCA A Ala
GCG A Ala
GAT D Asp
GAC D Asp
GAA E Glu
GAG E Glu
GGT G Gly
GGC G Gly
GGA G Gly
GGG G Gly
Challenge of reverse translation
A particular protein follows from the translation of a DNA sequence whereas the reverse translation
need not have a specific solution according to the Genetic Code. The Genetic Code is degenerate
which means that a particular amino acid can be translated into more than one codon. Hence
there are ambiguities of the reverse translation.
Solving the ambiguities of reverse translation
In order to solve these ambiguities of reverse translation you can define how to prioritize the
codon selection, e.g:
• Choose a codon randomly.
• Select the most frequent codon in a given organism.
• Randomize a codon, but with respect to its frequency in the organism.
As an example we want to translate an alanine to the corresponding codon. Four different codons
can be used for this reverse translation; GCU, GCC, GCA or GCG. By picking either one by random
choice we will get an alanine.
The most frequent codon, coding for an alanine in E. coli is GCG, encoding 33.7% of all alanines.
Then comes GCC (25.5%), GCA (20.3%) and finally GCU (15.3%). The data are retrieved from the
Codon usage database, see below. Always picking the most frequent codon does not necessarily
give the best answer.
By selecting codons from a distribution of calculated codon frequencies, the DNA sequence
obtained after the reverse translation, holds the correct (or nearly correct) codon distribution. It
CHAPTER 16. PROTEIN ANALYSES
259
should be kept in mind that the obtained DNA sequence is not necessarily identical to the original
one encoding the protein in the first place, due to the degeneracy of the genetic code.
In order to obtain the best possible result of the reverse translation, one should use the codon
frequency table from the correct organism or a closely related species. The codon usage of the
mitochondrial chromosome are often different from the native chromosome(s), thus mitochondrial
codon frequency tables should only be used when working specifically with mitochondria.
Other useful resources
The Genetic Code at NCBI:
http://www.ncbi.nlm.nih.gov/Taxonomy/Utils/wprintgc.cgi?mode=c
Codon usage database:
http://www.kazusa.or.jp/codon/
Wikipedia on the genetic code
http://en.wikipedia.org/wiki/Genetic_code
Creative Commons License
All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational
purposes, under the following conditions: You must attribute the work in its original form and
"CLC bio" has to be clearly labeled as author and provider of the work. You may not use this
work for commercial purposes. You may not alter, transform, nor build upon this work.
See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on
how to use the contents.
16.10
Proteolytic cleavage detection
CLC Protein Workbench offers to analyze protein sequences with respect to cleavage by a
selection of proteolytic enzymes. This section explains how to adjust the detection parameters
and offers basic information on proteolytic cleavage in general.
16.10.1
Proteolytic cleavage parameters
Given a protein sequence, CLC Protein Workbench detects proteolytic cleavage sites in accordance
with detection parameters and shows the detected sites as annotations on the sequence and in
textual format in a table below the sequence view.
Detection of proteolytic cleavage sites is initiated by:
right-click a protein sequence in Navigation Area | Toolbox | Protein Analyses (
| Proteolytic Cleavage, ( )
This opens the dialog shown in figure 16.23:
)
CHAPTER 16. PROTEIN ANALYSES
260
Figure 16.23: Choosing sequence CAA32220 for proteolytic cleavage.
CLC Protein Workbench allows you to detect proteolytic cleavages for several sequences at a
time. Correct the list of sequences by selecting a sequence and clicking the arrows pointing left
and right. Then click Next to go to Step 2.
In Step 2 you can select proteolytic cleavage enzymes. The list of available enzymes will be
expanded continuously. Presently, the list contains the enzymes shown in figure 16.24. The full
list of enzymes and their cleavage patterns can be seen in Appendix, section E.
Figure 16.24: Setting parameters for proteolytic cleavage detection.
Select the enzymes you want to use for detection. When the relevant enzymes are chosen, click
Next.
In Step 3 you can set parameters for the detection. This limits the number of detected cleavages.
Figure 16.25 shows an example of how parameters can be set.
• Min. and max. number of cleavage sites. Certain proteolytic enzymes cleave at many
positions in the amino acid sequence. For instance proteinase K cleaves at nine different
amino acids, regardless of the surrounding residues. Thus, it can be very useful to limit the
number of actual cleavage sites before running the analysis.
CHAPTER 16. PROTEIN ANALYSES
261
Figure 16.25: Setting parameters for proteolytic cleavage detection.
• Min. and max. fragment length Likewise, it is possible to limit the output to only display
sequence fragments between a chosen length. Both a lower and upper limit can be chosen.
• Min. and max. fragment mass The molecular weight is not necessarily directly correlated
to the fragment length as amino acids have different molecular masses. For that reason it
is also possible to limit the search for proteolytic cleavage sites to mass-range.
Example!: If you have one protein sequence but you only want to show which enzymes cut
between two and four times. Then you should select "The enzymes has more cleavage sites than
2" and select "The enzyme has less cleavage sites than 4". In the next step you should simply
select all enzymes. This will result in a view where only enzymes which cut 2,3 or 4 times are
presented.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
The result of the detection is displayed in figure 16.26.
Figure 16.26: The result of the proteolytic cleavage detection.
CHAPTER 16. PROTEIN ANALYSES
262
Depending on the settings in the program, the output of the proteolytic cleavage site detection
will display two views on the screen. The top view shows the actual protein sequence with the
predicted cleavage sites indicated by small arrows. If no labels are found on the arrows they can
be enabled by setting the labels in the "annotation layout" in the preference panel. The bottom
view shows a text output of the detection, listing the individual fragments and information on
these.
16.10.2
Bioinformatics explained: Proteolytic cleavage
Proteolytic cleavage is basically the process of breaking the peptide bonds between amino acids
in proteins. This process is carried out by enzymes called peptidases, proteases or proteolytic
cleavage enzymes.
Proteins often undergo proteolytic processing by specific proteolytic enzymes (proteases/peptidases)
before final maturation of the protein. Proteins can also be cleaved as a result of intracellular
processing of, for example, misfolded proteins. Another example of proteolytic processing of
proteins is secretory proteins or proteins targeted to organelles, which have their signal peptide
removed by specific signal peptidases before release to the extracellular environment or specific
organelle.
Below a few processes are listed where proteolytic enzymes act on a protein substrate.
• N-terminal methionine residues are often removed after translation.
• Signal peptides or targeting sequences are removed during translocation through a membrane.
• Viral proteins that were translated from a monocistronic mRNA are cleaved.
• Proteins or peptides can be cleaved and used as nutrients.
• Precursor proteins are often processed to yield the mature protein.
Proteolytic cleavage of proteins has shown its importance in laboratory experiments where it is
often useful to work with specific peptide fragments instead of entire proteins.
Proteases also have commercial applications. As an example proteases can be used as
detergents for cleavage of proteinaceous stains in clothing.
The general nomenclature of cleavage site positions of the substrate were formulated by
Schechter and Berger, 1967-68 [Schechter and Berger, 1967], [Schechter and Berger, 1968].
They designate the cleavage site between P1-P1', incrementing the numbering in the N-terminal
direction of the cleaved peptide bond (P2, P3, P4, etc..). On the carboxyl side of the cleavage
site the numbering is incremented in the same way (P1', P2', P3' etc. ). This is visualized in
figure 16.27.
Proteases often have a specific recognition site where the peptide bond is cleaved. As an
example trypsin only cleaves at lysine or arginine residues, but it does not matter (with a few
exceptions) which amino acid is located at position P1'(carboxyterminal of the cleavage site).
Another example is trombin which cleaves if an arginine is found in position P1, but not if a D or
E is found in position P1' at the same time. (See figure 16.28).
CHAPTER 16. PROTEIN ANALYSES
263
Figure 16.27: Nomenclature of the peptide substrate. The substrate is cleaved between position
P1-P1'.
Figure 16.28: Hydrolysis of the peptide bond between two amino acids. Trypsin cleaves unspecifically at lysine or arginine residues whereas trombin cleaves at arginines if asparate or glutamate
is absent.
Bioinformatics approaches are used to identify potential peptidase cleavage sites. Fragments
can be found by scanning the amino acid sequence for patterns which match the corresponding
cleavage site for the protease. When identifying cleaved fragments it is relatively important to
know the calculated molecular weight and the isoelectric point.
Other useful resources
The Peptidase Database: http://merops.sanger.ac.uk/
Creative Commons License
All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational
purposes, under the following conditions: You must attribute the work in its original form and
"CLC bio" has to be clearly labeled as author and provider of the work. You may not use this
work for commercial purposes. You may not alter, transform, nor build upon this work.
CHAPTER 16. PROTEIN ANALYSES
264
See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on
how to use the contents.
Chapter 17
Restriction site analyses
Contents
17.1 Dynamic restriction sites . . . . . . . . . . . . . . . .
17.1.1 Sort enzymes . . . . . . . . . . . . . . . . . . .
17.1.2 Manage enzymes . . . . . . . . . . . . . . . . .
17.2 Restriction site analysis from the Toolbox . . . . . .
17.2.1 Selecting, sorting and filtering enzymes . . . . .
17.2.2 Number of cut sites . . . . . . . . . . . . . . . .
17.2.3 Output of restriction map analysis . . . . . . . .
17.2.4 Restriction sites as annotation on the sequence
17.2.5 Table of restriction sites . . . . . . . . . . . . .
17.2.6 Table of restriction fragments . . . . . . . . . . .
17.2.7 Gel . . . . . . . . . . . . . . . . . . . . . . . . .
17.3 Gel electrophoresis . . . . . . . . . . . . . . . . . . .
17.3.1 Separate fragments of sequences on gel . . . .
17.3.2 Separate sequences on gel . . . . . . . . . . . .
17.3.3 Gel view . . . . . . . . . . . . . . . . . . . . . .
17.4 Restriction enzyme lists . . . . . . . . . . . . . . . .
17.4.1 Create enzyme list . . . . . . . . . . . . . . . . .
17.4.2 View and modify enzyme list . . . . . . . . . . .
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
.
266
267
268
270
270
271
272
273
273
274
275
275
276
276
276
278
278
280
There are two ways of finding and showing restriction sites:
• In many cases, the dynamic restriction sites found in the Side Panel of sequence views will
be useful, since it is a quick and easy way of showing restriction sites.
• In the Toolbox you will find the other way of doing restriction site analyses. This way
provides more control of the analysis and gives you more output options, e.g. a table
of restriction sites and you can perform the same restriction map analysis on several
sequences in one step.
This chapter first describes the dynamic restriction sites, followed by "the toolbox way". This
section also includes an explanation of how to simulate a gel with the selected enzymes. The
265
CHAPTER 17. RESTRICTION SITE ANALYSES
266
final section in this chapter focuses on enzyme lists which represent an easy way of managing
restriction enzymes.
17.1
Dynamic restriction sites
If you open a sequence, a sequence list etc, you will find the Restriction Sites group in the Side
Panel.
As shown in figure 17.1 you can display restriction sites as colored triangles and lines on the
sequence. The Restriction sites group in the side panel shows a list of enzymes, represented
by different colors corresponding to the colors of the triangles on the sequence. By selecting or
deselecting the enzymes in the list, you can specify which enzymes' restriction sites should be
displayed.
Figure 17.1: Showing restriction sites of ten restriction enzymes.
The color of the restriction enzyme can be changed by clicking the colored box next to the
enzyme's name. The name of the enzyme can also be shown next to the restriction site by
selecting Show name flags above the list of restriction enzymes.
There is also an option to specify how the Labels shown be shown:
• No labels. This will just display the cut site with no information about the name of the
enzyme. Placing the mouse button on the cut site will reveal this information as a tool tip.
• Flag. This will place a flag just above the sequence with the enzyme name (see an example
in figure 17.2). Note that this option will make it hard to see when several cut sites are
located close to each other. In the circular view, this option is replaced by the Radial option:
CHAPTER 17. RESTRICTION SITE ANALYSES
267
• Radial. This option is only available in the circular view. It will place the restriction site
labels as close to the cut site as possible (see an example in figure 17.4).
• Stacked. This is similar to the flag option for linear sequence views, but it will stack the
labels so that all enzymes are shown. For circular views, it will align all the labels on each
side of the circle. This can be useful for clearly seeing the order of the cut sites when they
are located closely together (see an example in figure 17.3).
Figure 17.2: Restriction site labels shown as flags.
Figure 17.3: Restriction site labels stacked.
Figure 17.4: Restriction site labels in radial layout.
Note that in a circular view, the Stacked and Radial options also affect the layout of annotations.
17.1.1
Sort enzymes
Just above the list of enzymes there are three buttons to be used for sorting the list (see
figure 17.5):
Figure 17.5: Buttons to sort restriction enzymes.
• Sort enzymes alphabetically (
alphabetically.
).
Clicking this button will sort the list of enzymes
• Sort enzymes by number of restriction sites (
groups:
Non-cutters.
Single cutters.
Double cutters.
Multiple cutters.
). This will divide the enzymes into four
CHAPTER 17. RESTRICTION SITE ANALYSES
268
There is a checkbox for each group which can be used to hide / show all the enzymes in a
group.
•
• Sort enzymes by overhang (
). This will divide the enzymes into three groups:
Blunt. Enzymes cutting both strands at the same position.
3'. Enzymes producing an overhang at the 3' end.
5'. Enzymes producing an overhang at the 5' end.
There is a checkbox for each group which can be used to hide / show all the enzymes in a
group.
17.1.2
Manage enzymes
The list of restriction enzymes contains per default 20 of the most popular enzymes, but you can
easily modify this list and add more enzymes by clicking the Manage enzymes button. This will
display the dialog shown in figure 17.6.
Figure 17.6: Adding or removing enzymes from the Side Panel.
At the top, you can choose to Use existing enzyme list. Clicking this option lets you select an
enzyme list which is stored in the Navigation Area. See section 17.4 for more about creating
and modifying enzyme lists.
Below there are two panels:
• To the left, you see all the enzymes that are in the list select above. If you have not chosen
to use an existing enzyme list, this panel shows all the enzymes available 1 .
• To the right, there is a list of the enzymes that will be used.
Select enzymes in the left side panel and add them to the right panel by double-clicking or clicking
the Add button ( ). If you e.g. wish to use EcoRV and BamHI, select these two enzymes and
add them to the right side panel.
1
The CLC Protein Workbench comes with a standard set of enzymes based on http://www.rebase.neb.com.
You can customize the enzyme database for your installation, see section ??
CHAPTER 17. RESTRICTION SITE ANALYSES
269
If you wish to use all the enzymes in the list:
Click in the panel to the left | press Ctrl + A (
+ A on Mac) | Add (
)
The enzymes can be sorted by clicking the column headings, i.e. Name, Overhang, Methylation
or Popularity. This is particularly useful if you wish to use enzymes which produce e.g. a 3'
overhang. In this case, you can sort the list by clicking the Overhang column heading, and all the
enzymes producing 3' overhangs will be listed together for easy selection.
When looking for a specific enzyme, it is easier to use the Filter. If you wish to find e.g. HindIII
sites, simply type HindIII into the filter, and the list of enzymes will shrink automatically to only
include the HindIII enzyme. This can also be used to only show enzymes producing e.g. a 3'
overhang as shown in figure 17.20.
Figure 17.7: Selecting enzymes.
If you need more detailed information and filtering of the enzymes, either place your mouse
cursor on an enzyme for one second to display additional information (see figure 17.21), or use
the view of enzyme lists (see 17.4).
Figure 17.8: Showing additional information about an enzyme like recognition sequence or a list of
commercial vendors.
At the bottom of the dialog, you can select to save this list of enzymes as a new file. In this way,
you can save the selection of enzymes for later use.
When you click Finish, the enzymes are added to the Side Panel and the cut sites are shown on
the sequence.
CHAPTER 17. RESTRICTION SITE ANALYSES
270
If you have specified a set of enzymes which you always use, it will probably be a good idea to
save the settings in the Side Panel (see section 3.2.7) for future use.
17.2
Restriction site analysis from the Toolbox
Besides the dynamic restriction sites, you can do a more elaborate restriction map analysis with
more output format using the Toolbox:
Toolbox | Restriction Sites (
) | Restriction Site Analysis (
)
This will display the dialog shown in figure 17.9.
Figure 17.9: Choosing sequence ATP8a1 mRNA for restriction map analysis.
If a sequence was selected before choosing the Toolbox action, this sequence is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove sequences or
sequence lists from the selected elements.
17.2.1
Selecting, sorting and filtering enzymes
Clicking Next lets you define which enzymes to use as basis for finding restriction sites on the
sequence. At the top, you can choose to Use existing enzyme list. Clicking this option lets you
select an enzyme list which is stored in the Navigation Area. See section 17.4 for more about
creating and modifying enzyme lists.
Below there are two panels:
• To the left, you see all the enzymes that are in the list select above. If you have not chosen
to use an existing enzyme list, this panel shows all the enzymes available 2 .
• To the right, there is a list of the enzymes that will be used.
Select enzymes in the left side panel and add them to the right panel by double-clicking or clicking
the Add button ( ). If you e.g. wish to use EcoRV and BamHI, select these two enzymes and
add them to the right side panel.
2
The CLC Protein Workbench comes with a standard set of enzymes based on http://www.rebase.neb.com.
You can customize the enzyme database for your installation, see section ??
CHAPTER 17. RESTRICTION SITE ANALYSES
271
If you wish to use all the enzymes in the list:
Click in the panel to the left | press Ctrl + A (
+ A on Mac) | Add (
)
The enzymes can be sorted by clicking the column headings, i.e. Name, Overhang, Methylation
or Popularity. This is particularly useful if you wish to use enzymes which produce e.g. a 3'
overhang. In this case, you can sort the list by clicking the Overhang column heading, and all the
enzymes producing 3' overhangs will be listed together for easy selection.
When looking for a specific enzyme, it is easier to use the Filter. If you wish to find e.g. HindIII
sites, simply type HindIII into the filter, and the list of enzymes will shrink automatically to only
include the HindIII enzyme. This can also be used to only show enzymes producing e.g. a 3'
overhang as shown in figure 17.20.
Figure 17.10: Selecting enzymes.
If you need more detailed information and filtering of the enzymes, either place your mouse
cursor on an enzyme for one second to display additional information (see figure 17.21), or use
the view of enzyme lists (see 17.4).
Figure 17.11: Showing additional information about an enzyme like recognition sequence or a list
of commercial vendors.
17.2.2
Number of cut sites
Clicking Next confirms the list of enzymes which will be included in the analysis, and takes you
to the dialog shown in figure 17.12.
CHAPTER 17. RESTRICTION SITE ANALYSES
272
Figure 17.12: Selecting number of cut sites.
If you wish the output of the restriction map analysis only to include restriction enzymes which
cut the sequence a specific number of times, use the checkboxes in this dialog:
• No restriction site (0)
• One restriction site (1)
• Two restriction sites (2)
• Three restriction site (3)
• N restriction sites
Minimum
Maximum
• Any number of restriction sites > 0
The default setting is to include the enzymes which cut the sequence one or two times.
You can use the checkboxes to perform very specific searches for restriction sites: e.g. if you
wish to find enzymes which do not cut the sequence, or enzymes cutting exactly twice.
17.2.3
Output of restriction map analysis
Clicking next shows the dialog in figure 17.13.
This dialog lets you specify how the result of the restriction map analysis should be presented:
• Add restriction sites as annotations to sequence(s). This option makes it possible to see
the restriction sites on the sequence (see figure 17.14) and save the annotations for later
use.
• Create restriction map. When a restriction map is created, it can be shown in three
different ways:
CHAPTER 17. RESTRICTION SITE ANALYSES
273
Figure 17.13: Choosing to add restriction sites as annotations or creating a restriction map.
As a table of restriction sites as shown in figure 17.15. If more than one sequence
were selected, the table will include the restriction sites of all the sequences. This
makes it easy to compare the result of the restriction map analysis for two sequences.
As a table of fragments which shows the sequence fragments that would be the result
of cutting the sequence with the selected enzymes (see figure17.16).
As a virtual gel simulation which shows the fragments as bands on a gel (see
figure 17.18).
For more information about gel electrophoresis, see section 17.3.
The following sections will describe these output formats in more detail.
In order to complete the analysis click Finish (see section 9.1 for information about the Save and
Open options).
17.2.4
Restriction sites as annotation on the sequence
If you chose to add the restriction sites as annotation to the sequence, the result will be similar
to the sequence shown in figure 17.14.
See section 10.3 for more information about viewing
Figure 17.14: The result of the restriction analysis shown as annotations.
annotations.
17.2.5
Table of restriction sites
The restriction map can be shown as a table of restriction sites (see figure 17.15).
Each row in the table represents a restriction enzyme. The following information is available for
each enzyme:
CHAPTER 17. RESTRICTION SITE ANALYSES
274
Figure 17.15: The result of the restriction analysis shown as annotations.
• Sequence. The name of the sequence which is relevant if you have performed restriction
map analysis on more than one sequence.
• Name. The name of the enzyme.
• Pattern. The recognition sequence of the enzyme.
• Overhang. The overhang produced by cutting with the enzyme (3', 5' or Blunt).
• Number of cut sites.
• Cut position(s). The position of each cut.
, If the enzyme cuts more than once, the positions are separated by commas.
[] If the enzyme's recognition sequence is on the negative strand, the cut position is
put in brackets (as the enzyme TsoI in figure 17.15 whose cut position is [134]).
() Some enzymes cut the sequence twice for each recognition site, and in this case
the two cut positions are surrounded by parentheses.
17.2.6
Table of restriction fragments
The restriction map can be shown as a table of fragments produced by cutting the sequence with
the enzymes:
Click the Fragments button (
) at the bottom of the view
The table is shown in see figure 17.16.
Each row in the table represents a fragment. If more than one enzyme cuts in the same region,
or if an enzyme's recognition site is cut by another enzyme, there will be a fragment for each of
the possible cut combinations 3 . The following information is available for each fragment.
• Sequence. The name of the sequence which is relevant if you have performed restriction
map analysis on more than one sequence.
• Length. The length of the fragment. If there are overhangs of the fragment, these are
included in the length (both 3' and 5' overhangs).
• Region. The fragment's region on the original sequence.
3
Furthermore, if this is the case, you will see the names of the other enzymes in the Conflicting Enzymes column
CHAPTER 17. RESTRICTION SITE ANALYSES
275
Figure 17.16: The result of the restriction analysis shown as annotations.
• Overhangs. If there is an overhang, this is displayed with an abbreviated version of the
fragment and its overhangs. The two rows of dots (.) represent the two strands of the
fragment and the overhang is visualized on each side of the dots with the residue(s) that
make up the overhang. If there are only the two rows of dots, it means that there is no
overhang.
• Left end. The enzyme that cuts the fragment to the left (5' end).
• Right end. The enzyme that cuts the fragment to the right (3' end).
• Conflicting enzymes. If more than one enzyme cuts at the same position, or if an enzyme's
recognition site is cut by another enzyme, a fragment is displayed for each possible
combination of cuts. At the same time, this column will display the enzymes that are in
conflict. If there are conflicting enzymes, they will be colored red to alert the user. If
the same experiment were performed in the lab, conflicting enzymes could lead to wrong
results. For this reason, this functionality is useful to simulate digestions with complex
combinations of restriction enzymes.
If views of both the fragment table and the sequence are open, clicking in the fragment table will
select the corresponding region on the sequence.
17.2.7
Gel
The restriction map can also be shown as a gel. This is described in section 17.3.1.
17.3
Gel electrophoresis
CLC Protein Workbench enables the user to simulate the separation of nucleotide sequences on
a gel. This feature is useful when e.g. designing an experiment which will allow the differentiation
CHAPTER 17. RESTRICTION SITE ANALYSES
276
of a successful and an unsuccessful cloning experiment on the basis of a restriction map.
There are two main ways to simulate gel separation of nucleotide sequences:
• One or more sequences can be digested with restriction enzymes and the resulting
fragments can be separated on a gel.
• A number of existing sequences can be separated on a gel.
There are several ways to apply these functionalities as described below.
17.3.1
Separate fragments of sequences on gel
This section explains how to simulate a gel electrophoresis of one or more sequences which are
digested with restriction enzymes. There are two ways to do this:
• When performing the Restriction Site Analysis from the Toolbox, you can choose to create
a restriction map which can be shown as a gel. This is explained in section 17.2.
• From all the graphical views of sequences, you can right-click the name of the sequence
and choose: Digest Sequence with Selected Enzymes and Run on Gel ( ). The views
where this option is available are listed below:
Circular view (see section 10.2).
Ordinary sequence view (see section 10.1).
Graphical view of sequence lists (see section 10.7).
Furthermore, you can also right-click an empty part of the view of the graphical view of
sequence lists and choose Digest All Sequences with Selected Enzymes and Run on Gel.
Note! When using the right-click options, the sequence will be digested with the enzymes
that are selected in the Side Panel. This is explained in section 10.1.2.
The view of the gel is explained in section 17.3.3
17.3.2
Separate sequences on gel
To separate sequences without restriction enzyme digestion, first create a sequence list of the
sequences in question (see section 10.7). Then click the Gel button ( ) at the bottom of the
view of the sequence list.
For more information about the view of the gel, see the next section.
17.3.3
Gel view
In figure 17.18 you can see a simulation of a gel with its Side Panel to the right. This view will
be explained in this section.
CHAPTER 17. RESTRICTION SITE ANALYSES
277
Figure 17.17: A sequence list shown as a gel.
Figure 17.18: Five lanes showing fragments of five sequences cut with restriction enzymes.
Information on bands / fragments
You can get information about the individual bands by hovering the mouse cursor on the band of
interest. This will display a tool tip with the following information:
• Fragment length
• Fragment region on the original sequence
• Enzymes cutting at the left and right ends, respectively
CHAPTER 17. RESTRICTION SITE ANALYSES
278
For gels comparing whole sequences, you will see the sequence name and the length of the
sequence.
Note! You have to be in Selection (
) or Pan (
) mode in order to get this information.
It can be useful to add markers to the gel which enables you to compare the sizes of the bands.
This is done by clicking Show marker ladder in the Side Panel.
Markers can be entered into the text field, separated by commas.
Modifying the layout
The background of the lane and the colors of the bands can be changed in the Side Panel. Click
the colored box to display a dialog for picking a color. The slider Scale band spread can be used
to adjust the effective time of separation on the gel, i.e. how much the bands will be spread over
the lane. In a real electrophoresis experiment this property will be determined by several factors
including time of separation, voltage and gel density.
You can also choose how many lanes should be displayed:
• Sequences in separate lanes. This simulates that a gel is run for each sequence.
• All sequences in one lane. This simulates that one gel is run for all sequences.
You can also modify the layout of the view by zooming in or out. Click Zoom in (
( ) in the Toolbar and click the view.
) or Zoom out
Finally, you can modify the format of the text heading each lane in the Text format preferences
in the Side Panel.
17.4
Restriction enzyme lists
CLC Protein Workbench includes all the restriction enzymes available in the REBASE database4 .
However, when performing restriction site analyses, it is often an advantage to use a customized
list of enzymes. In this case, the user can create special lists containing e.g. all enzymes
available in the laboratory freezer, all enzymes used to create a given restriction map or all
enzymes that are available form the preferred vendor.
In the example data (see section 1.6.2) under Nucleotide->Restriction analysis, there are two
enzyme lists: one with the 50 most popular enzymes, and another with all enzymes that are
included in the CLC Protein Workbench.
This section describes how you can create an enzyme list, and how you can modify it.
17.4.1
Create enzyme list
CLC Protein Workbench uses enzymes from the REBASE restriction enzyme database at http:
//rebase.neb.com5 .
To create an enzyme list of a subset of these enzymes:
4
5
You can customize the enzyme database for your installation, see section ??
You can customize the enzyme database for your installation, see section ??
CHAPTER 17. RESTRICTION SITE ANALYSES
File | New | Enzyme list (
279
)
This opens the dialog shown in figure 17.19
Figure 17.19: Choosing enzymes for the new enzyme list.
At the top, you can choose to Use existing enzyme list. Clicking this option lets you select an
enzyme list which is stored in the Navigation Area. See section 17.4 for more about creating
and modifying enzyme lists.
Below there are two panels:
• To the left, you see all the enzymes that are in the list select above. If you have not chosen
to use an existing enzyme list, this panel shows all the enzymes available 6 .
• To the right, there is a list of the enzymes that will be used.
Select enzymes in the left side panel and add them to the right panel by double-clicking or clicking
the Add button ( ). If you e.g. wish to use EcoRV and BamHI, select these two enzymes and
add them to the right side panel.
If you wish to use all the enzymes in the list:
Click in the panel to the left | press Ctrl + A (
+ A on Mac) | Add (
)
The enzymes can be sorted by clicking the column headings, i.e. Name, Overhang, Methylation
or Popularity. This is particularly useful if you wish to use enzymes which produce e.g. a 3'
overhang. In this case, you can sort the list by clicking the Overhang column heading, and all the
enzymes producing 3' overhangs will be listed together for easy selection.
When looking for a specific enzyme, it is easier to use the Filter. If you wish to find e.g. HindIII
sites, simply type HindIII into the filter, and the list of enzymes will shrink automatically to only
include the HindIII enzyme. This can also be used to only show enzymes producing e.g. a 3'
overhang as shown in figure 17.20.
If you need more detailed information and filtering of the enzymes, either place your mouse
cursor on an enzyme for one second to display additional information (see figure 17.21), or use
the view of enzyme lists (see 17.4).
Click Finish to open the enzyme list.
6
The CLC Protein Workbench comes with a standard set of enzymes based on http://www.rebase.neb.com.
You can customize the enzyme database for your installation, see section ??
CHAPTER 17. RESTRICTION SITE ANALYSES
280
Figure 17.20: Selecting enzymes.
Figure 17.21: Showing additional information about an enzyme like recognition sequence or a list
of commercial vendors.
17.4.2
View and modify enzyme list
An enzyme list is shown in figure 17.22.
The list can be sorted by clicking the columns,
Figure 17.22: An enzyme list.
and you can use the filter at the top right corner to search for specific enzymes, recognition
sequences etc.
If you wish to remove or add enzymes, click the Add/Remove Enzymes button at the bottom of
the view. This will present the same dialog as shown in figure 17.19 with the enzyme list shown
to the right.
If you wish to extract a subset of an enzyme list:
CHAPTER 17. RESTRICTION SITE ANALYSES
281
open the list | select the relevant enzymes | right-click | Create New Enzyme List
from Selection ( )
If you combined this method with the filter located at the top of the view, you can extract a
very specific set of enzymes. E.g. if you wish to create a list of enzymes sold by a particular
distributor, type the name of the distributor into the filter, and select and create a new enzyme
list from the selection.
Chapter 18
Sequence alignment
Contents
18.1 Create an alignment
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 283
18.1.1
Gap costs . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 284
18.1.2
Fast or accurate alignment algorithm . . . . . . . . . . . . . . . . . . . . 284
18.1.3
Aligning alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 285
18.1.4
Fixpoints . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 286
18.2 View alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 288
18.2.1
Bioinformatics explained: Sequence logo . . . . . . . . . . . . . . . . . . 290
18.3 Edit alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292
18.3.1
Move residues and gaps . . . . . . . . . . . . . . . . . . . . . . . . . . 292
18.3.2
Insert gaps . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 292
18.3.3
Delete residues and gaps . . . . . . . . . . . . . . . . . . . . . . . . . . 292
18.3.4
Copy annotations to other sequences . . . . . . . . . . . . . . . . . . . 293
18.3.5
18.3.6
Move sequences up and down . . . . . . . . . . . . . . . . . . . . . . . 293
Delete, rename and add sequences . . . . . . . . . . . . . . . . . . . . 293
18.3.7
Realign selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 294
18.4 Join alignments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 294
18.4.1
How alignments are joined . . . . . . . . . . . . . . . . . . . . . . . . . 296
18.5 Pairwise comparison . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 296
18.5.1
Pairwise comparison on alignment selection . . . . . . . . . . . . . . . . 296
18.5.2
Pairwise comparison parameters . . . . . . . . . . . . . . . . . . . . . . 297
18.5.3
The pairwise comparison table . . . . . . . . . . . . . . . . . . . . . . . 298
18.6 Bioinformatics explained: Multiple alignments . . . . . . . . . . . . . . . . . 299
18.6.1
Use of multiple alignments . . . . . . . . . . . . . . . . . . . . . . . . . 299
18.6.2
Constructing multiple alignments . . . . . . . . . . . . . . . . . . . . . . 299
CLC Protein Workbench can align nucleotides and proteins using a progressive alignment algorithm
(see section 18.6 or read the White paper on alignments in the Science section of http:
//www.clcbio.com).
This chapter describes how to use the program to align sequences. The chapter also describes
alignment algorithms in more general terms.
282
CHAPTER 18. SEQUENCE ALIGNMENT
18.1
283
Create an alignment
Alignments can be created from sequences, sequence lists (see section 10.7), existing alignments and from any combination of the three.
To create an alignment in CLC Protein Workbench:
select sequences to align | Toolbox in the Menu Bar | Alignments and Trees (
Create Alignment ( )
)|
or select sequences to align | right-click any selected sequence | Toolbox | Alignments
and Trees ( ) | Create Alignment ( )
This opens the dialog shown in figure 18.1.
Figure 18.1: Creating an alignment.
If you have selected some elements before choosing the Toolbox action, they are now listed
in the Selected Elements window of the dialog. Use the arrows to add or remove sequences,
sequence lists or alignments from the selected elements. Click Next to adjust alignment
algorithm parameters. Clicking Next opens the dialog shown in figure 18.2.
Figure 18.2: Adjusting alignment algorithm parameters.
CHAPTER 18. SEQUENCE ALIGNMENT
18.1.1
284
Gap costs
The alignment algorithm has three parameters concerning gap costs: Gap open cost, Gap
extension cost and End gap cost. The precision of these parameters is to one place of decimal.
• Gap open cost. The price for introducing gaps in an alignment.
• Gap extension cost. The price for every extension past the initial gap.
If you expect a lot of small gaps in your alignment, the Gap open cost should equal the Gap
extension cost. On the other hand, if you expect few but large gaps, the Gap open cost should
be set significantly higher than the Gap extension cost.
However, for most alignments it is a good idea to make the Gap open cost quite a bit higher
than the Gap extension cost. The default values are 10.0 and 1.0 for the two parameters,
respectively.
• End gap cost. The price of gaps at the beginning or the end of the alignment. One of the
advantages of the CLC Protein Workbench alignment method is that it provides flexibility in
the treatment of gaps at the ends of the sequences. There are three possibilities:
Free end gaps. Any number of gaps can be inserted in the ends of the sequences
without any cost.
Cheap end gaps. All end gaps are treated as gap extensions and any gaps past 10
are free.
End gaps as any other. Gaps at the ends of sequences are treated like gaps in any
other place in the sequences.
When aligning a long sequence with a short partial sequence, it is ideal to use free end gaps,
since this will be the best approximation to the situation. The many gaps inserted at the ends
are not due to evolutionary events, but rather to partial data.
Many homologous proteins have quite different ends, often with large insertions or deletions. This
confuses alignment algorithms, but using the Cheap end gaps option, large gaps will generally
be tolerated at the sequence ends, improving the overall alignment. This is the default setting of
the algorithm.
Finally, treating end gaps like any other gaps is the best option when you know that there are no
biologically distinct effects at the ends of the sequences.
Figures 18.3 and 18.4 illustrate the differences between the different gap scores at the sequence
ends.
18.1.2
Fast or accurate alignment algorithm
CLC Protein Workbench has two algorithms for calculating alignments:
• Fast (less accurate). This allows for use of an optimized alignment algorithm which is very
fast. The fast option is particularly useful for data sets with very long sequences.
• Slow (very accurate). This is the recommended choice unless you find the processing time
too long.
CHAPTER 18. SEQUENCE ALIGNMENT
285
Figure 18.3: The first 50 positions of two different alignments of seven calpastatin sequences. The
top alignment is made with cheap end gaps, while the bottom alignment is made with end gaps
having the same price as any other gaps. In this case it seems that the latter scoring scheme gives
the best result.
Figure 18.4: The alignment of the coding sequence of bovine myoglobin with the full mRNA of
human gamma globin. The top alignment is made with free end gaps, while the bottom alignment
is made with end gaps treated as any other. The yellow annotation is the coding sequence in both
sequences. It is evident that free end gaps are ideal in this situation as the start codons are aligned
correctly in the top alignment. Treating end gaps as any other gaps in the case of aligning distant
homologs where one sequence is partial leads to a spreading out of the short sequence as in the
bottom alignment.
Both algorithms use progressive alignment. The faster algorithm builds the initial tree by doing
more approximate pairwise alignments than the slower option.
18.1.3
Aligning alignments
If you have selected an existing alignment in the first step (18.1), you have to decide how this
alignment should be treated.
• Redo alignment. The original alignment will be realigned if this checkbox is checked.
Otherwise, the original alignment is kept in its original form except for possible extra equally
sized gaps in all sequences of the original alignment. This is visualized in figure 18.5.
CHAPTER 18. SEQUENCE ALIGNMENT
286
Figure 18.5: The top figures shows the original alignment. In the bottom panel a single sequence
with four inserted X's are aligned to the original alignment. This introduces gaps in all sequences
of the original alignment. All other positions in the original alignment are fixed.
This feature is useful if you wish to add extra sequences to an existing alignment, in which case
you just select the alignment and the extra sequences and choose not to redo the alignment.
It is also useful if you have created an alignment where the gaps are not placed correctly. In this
case, you can realign the alignment with different gap cost parameters.
18.1.4
Fixpoints
With fixpoints, you can get full control over the alignment algorithm. The fixpoints are points on
the sequences that are forced to align to each other.
Fixpoints are added to sequences or alignments before clicking "Create alignment". To add a
fixpoint, open the sequence or alignment and:
Select the region you want to use as a fixpoint | right-click the selection | Set
alignment fixpoint here
This will add an annotation labeled "Fixpoint" to the sequence (see figure 18.6). Use this
procedure to add fixpoints to the other sequence(s) that should be forced to align to each other.
When you click "Create alignment" and go to Step 2, check Use fixpoints in order to force the
alignment algorithm to align the fixpoints in the selected sequences to each other.
In figure 18.7 the result of an alignment using fixpoints is illustrated.
You can add multiple fixpoints, e.g. adding two fixpoints to the sequences that are aligned will
force their first fixpoints to be aligned to each other, and their second fixpoints will also be
CHAPTER 18. SEQUENCE ALIGNMENT
287
Figure 18.6: Adding a fixpoint to a sequence in an existing alignment. At the top you can see a
fixpoint that has already been added.
Figure 18.7: Realigning using fixpoints. In the top view, fixpoints have been added to two of the
sequences. In the view below, the alignment has been realigned using the fixpoints. The three top
sequences are very similar, and therefore they follow the one sequence (number two from the top)
that has a fixpoint.
aligned to each other.
Advanced use of fixpoints
Fixpoints with the same names will be aligned to each other, which gives the opportunity for great
control over the alignment process. It is only necessary to change any fixpoint names in very
special cases.
One example would be three sequences A, B and C where sequences A and B has one copy of a
domain while sequence C has two copies of the domain. You can now force sequence A to align
to the first copy and sequence B to align to the second copy of the domains in sequence C. This
is done by inserting fixpoints in sequence C for each domain, and naming them 'fp1' and 'fp2'
CHAPTER 18. SEQUENCE ALIGNMENT
288
(for example). Now, you can insert a fixpoint in each of sequences A and B, naming them 'fp1'
and 'fp2', respectively. Now, when aligning the three sequences using fixpoints, sequence A will
align to the first copy of the domain in sequence C, while sequence B would align to the second
copy of the domain in sequence C.
You can name fixpoints by:
right-click the Fixpoint annotation | Edit Annotation (
'Name' field
18.2
) | type the name in the
View alignments
Since an alignment is a display of several sequences arranged in rows, the basic options for
viewing alignments are the same as for viewing sequences. Therefore we refer to section 10.1
for an explanation of these basic options.
However, there are a number of alignment-specific view options in the Alignment info and the
Nucleotide info in the Side Panel to the right of the view. Below is more information on these
view options.
Under Translation in the Nucleotide info, there is an extra checkbox: Relative to top sequence.
Checking this box will make the reading frames for the translation align with the top sequence so
that you can compare the effect of nucleotide differences on the protein level.
The options in the Alignment info relate to each column in the alignment:
• Consensus. Shows a consensus sequence at the bottom of the alignment. The consensus
sequence is based on every single position in the alignment and reflects an artificial
sequence which resembles the sequence information of the alignment, but only as one
single sequence. If all sequences of the alignment is 100% identical the consensus
sequence will be identical to all sequences found in the alignment. If the sequences of the
alignment differ the consensus sequence will reflect the most common sequences in the
alignment. Parameters for adjusting the consensus sequences are described below.
Limit. This option determines how conserved the sequences must be in order to agree
on a consensus. Here you can also choose IUPAC which will display the ambiguity
code when there are differences between the sequences. E.g. an alignment with A
and a G at the same position will display an R in the consensus line if the IUPAC
option is selected. (The IUPAC codes can be found in section H and G.)
No gaps. Checking this option will not show gaps in the consensus.
Ambiguous symbol. Select how ambiguities should be displayed in the consensus
line (as N, ?, *, . or -). This option has now effect if IUPAC is selected in the Limit list
above.
The Consensus Sequence can be opened in a new view, simply by right-clicking the
Consensus Sequence and click Open Consensus in New View.
• Conservation. Displays the level of conservation at each position in the alignment. The
conservation shows the conservation of all sequence positions. The height of the bar, or
the gradient of the color reflect how conserved that particular position is in the alignment.
If one position is 100% conserved the bar will be shown in full height, and it is colored in
the color specified at the right side of the gradient slider.
CHAPTER 18. SEQUENCE ALIGNMENT
289
Foreground color. Colors the letters using a gradient, where the right side color is
used for highly conserved positions and the left side color is used for positions that
are less conserved.
Background color. Sets a background color of the residues using a gradient in the
same way as described above.
Graph. Displays the conservation level as a graph at the bottom of the alignment.
The bar (default view) show the conservation of all sequence positions. The height of
the graph reflects how conserved that particular position is in the alignment. If one
position is 100% conserved the graph will be shown in full height. Learn how to export
the data behind the graph in section 7.4.
∗ Height. Specifies the height of the graph.
∗ Type. The type of the graph.
· Line plot. Displays the graph as a line plot.
· Bar plot. Displays the graph as a bar plot.
· Colors. Displays the graph as a color bar using a gradient like the foreground
and background colors.
∗ Color box. Specifies the color of the graph for line and bar plots, and specifies a
gradient for colors.
• Gap fraction. Which fraction of the sequences in the alignment that have gaps. The gap
fraction is only relevant if there are gaps in the alignment.
Foreground color. Colors the letter using a gradient, where the left side color is used
if there are relatively few gaps, and the right side color is used if there are relatively
many gaps.
Background color. Sets a background color of the residues using a gradient in the
same way as described above.
Graph. Displays the gap fraction as a graph at the bottom of the alignment (Learn how
to export the data behind the graph in section 7.4).
∗ Height. Specifies the height of the graph.
∗ Type. The type of the graph.
· Line plot. Displays the graph as a line plot.
· Bar plot. Displays the graph as a line plot.
· Colors. Displays the graph as a color bar using a gradient like the foreground
and background colors.
∗ Color box. Specifies the color of the graph for line and bar plots, and specifies a
gradient for colors.
• Color different residues. Indicates differences in aligned residues.
Foreground color. Colors the letter.
Background color. Sets a background color of the residues.
• Sequence logo. A sequence logo displays the frequencies of residues at each position
in an alignment. This is presented as the relative heights of letters, along with the degree
of sequence conservation as the total height of a stack of letters, measured in bits of
information. The vertical scale is in bits, with a maximum of 2 bits for nucleotides and
approximately 4.32 bits for amino acid residues. See section 18.2.1 for more details.
CHAPTER 18. SEQUENCE ALIGNMENT
290
Foreground color. Color the residues using a gradient according to the information
content of the alignment column. Low values indicate columns with high variability
whereas high values indicate columns with similar residues.
Background color. Sets a background color of the residues using a gradient in the
same way as described above.
Logo. Displays sequence logo at the bottom of the alignment.
∗ Height. Specifies the height of the sequence logo graph.
∗ Color. The sequence logo can be displayed in black or Rasmol colors. For protein
alignments, a polarity color scheme is also available, where hydrophobic residues
are shown in black color, hydrophilic residues as green, acidic residues as red
and basic residues as blue.
18.2.1
Bioinformatics explained: Sequence logo
In the search for homologous sequences, researchers are often interested in conserved
sites/residues or positions in a sequence which tend to differ a lot. Most researches use
alignments (see Bioinformatics explained: multiple alignments) for visualization of homology on a
given set of either DNA or protein sequences. In proteins, active sites in a given protein family
are often highly conserved. Thus, in an alignment these positions (which are not necessarily
located in proximity) are fully or nearly fully conserved. On the other hand, antigen binding sites in
the Fab unit of immunoglobulins tend to differ quite a lot, whereas the rest of the protein remains
relatively unchanged.
In DNA, promoter sites or other DNA binding sites are highly conserved (see figure 18.8). This is
also the case for repressor sites as seen for the Cro repressor of bacteriophage λ.
When aligning such sequences, regardless of whether they are highly variable or highly conserved
at specific sites, it is very difficult to generate a consensus sequence which covers the actual
variability of a given position. In order to better understand the information content or significance
of certain positions, a sequence logo can be used. The sequence logo displays the information
content of all positions in an alignment as residues or nucleotides stacked on top of each other
(see figure 18.8). The sequence logo provides a far more detailed view of the entire alignment
than a simple consensus sequence. Sequence logos can aid to identify protein binding sites on
DNA sequences and can also aid to identify conserved residues in aligned domains of protein
sequences and a wide range of other applications.
Each position of the alignment and consequently the sequence logo shows the sequence
information in a computed score based on Shannon entropy [Schneider and Stephens, 1990].
The height of the individual letters represent the sequence information content in that particular
position of the alignment.
A sequence logo is a much better visualization tool than a simple consensus sequence. An
example hereof is an alignment where in one position a particular residue is found in 70% of the
sequences. If a consensus sequence is used, it typically only displays the single residue with
70% coverage. In figure 18.8 an un-gapped alignment of 11 E. coli start codons including flanking
regions are shown. In this example, a consensus sequence would only display ATG as the start
codon in position 1, but when looking at the sequence logo it is seen that a GTG is also allowed
as a start codon.
CHAPTER 18. SEQUENCE ALIGNMENT
291
Figure 18.8: Ungapped sequence alignment of eleven E. coli sequences defining a start codon.
The start codons start at position 1. Below the alignment is shown the corresponding sequence
logo. As seen, a GTG start codon and the usual ATG start codons are present in the alignment. This
can also be visualized in the logo at position 1.
Calculation of sequence logos
A comprehensive walk-through of the calculation of the information content in sequence logos
is beyond the scope of this document but can be found in the original paper by [Schneider and
Stephens, 1990]. Nevertheless, the conservation of every position is defined as Rseq which is
the difference between the maximal entropy (Smax ) and the observed entropy for the residue
distribution (Sobs ),
X
N
Rseq = Smax − Sobs = log2 N − −
pn log2 pn
n=1
pn is the observed frequency of a amino acid residue or nucleotide of symbol n at a particular
position and N is the number of distinct symbols for the sequence alphabet, either 20 for
proteins or four for DNA/RNA. This means that the maximal sequence information content per
position is log2 4 = 2 bits for DNA/RNA and log2 20 ≈ 4.32 bits for proteins.
The original implementation by Schneider does not handle sequence gaps.
We have slightly modified the algorithm so an estimated logo is presented in areas with sequence
gaps.
If amino acid residues or nucleotides of one sequence are found in an area containing gaps, we
have chosen to show the particular residue as the fraction of the sequences. Example; if one
position in the alignment contain 9 gaps and only one alanine (A) the A represented in the logo
has a hight of 0.1.
Other useful resources
The website of Tom Schneider
http://www-lmmb.ncifcrf.gov/~toms/
WebLogo
CHAPTER 18. SEQUENCE ALIGNMENT
292
http://weblogo.berkeley.edu/
[Crooks et al., 2004]
18.3
Edit alignments
18.3.1
Move residues and gaps
The placement of gaps in the alignment can be changed by modifying the parameters when
creating the alignment (see section 18.1). However, gaps and residues can also be moved after
the alignment is created:
select one or more gaps or residues in the alignment | drag the selection to move
This can be done both for single sequences, but also for multiple sequences by making a
selection covering more than one sequence. When you have made the selection, the mouse
pointer turns into a horizontal arrow indicating that the selection can be moved (see figure 18.9).
Note! Residues can only be moved when they are next to a gap.
Figure 18.9: Moving a part of an alignment. Notice the change of mouse pointer to a horizontal
arrow.
18.3.2
Insert gaps
The placement of gaps in the alignment can be changed by modifying the parameters when
creating the alignment. However, gaps can also be added manually after the alignment is
created.
To insert extra gaps:
select a part of the alignment | right-click the selection | Add gaps before/after
If you have made a selection covering e.g. five residues, a gap of five will be inserted. In this way
you can easily control the number of gaps to insert. Gaps will be inserted in the sequences that
you selected. If you make a selection in two sequences in an alignment, gaps will be inserted
into these two sequences. This means that these two sequences will be displaced compared to
the other sequences in the alignment.
18.3.3
Delete residues and gaps
Residues or gaps can be deleted for individual sequences or for the whole alignment. For
individual sequences:
CHAPTER 18. SEQUENCE ALIGNMENT
293
select the part of the sequence you want to delete | right-click the selection | Edit
Selection ( ) | Delete the text in the dialog | Replace
The selection shown in the dialog will be replaced by the text you enter. If you delete the text,
the selection will be replaced by an empty text, i.e. deleted.
To delete entire columns:
select the part of the alignment you want to delete | right-click the selection |
Delete columns
The selection may cover one or more sequences, but the Delete columns function will always
apply to the entire alignment.
18.3.4
Copy annotations to other sequences
Annotations on one sequence can be transferred to other sequences in the alignment:
right-click the annotation | Copy Annotation to other Sequences
This will display a dialog listing all the sequences in the alignment. Next to each sequence is a
checkbox which is used for selecting which sequences, the annotation should be copied to. Click
Copy to copy the annotation.
If you wish to copy all annotations on the sequence, click the Copy All Annotations to other
Sequences.
18.3.5
Move sequences up and down
Sequences can be moved up and down in the alignment:
drag the name of the sequence up or down
When you move the mouse pointer over the label, the pointer will turn into a vertical arrow
indicating that the sequence can be moved.
The sequences can also be sorted automatically to let you save time moving the sequences
around. To sort the sequences alphabetically:
Right-click the name of a sequence | Sort Sequences Alphabetically
If you change the Sequence name (in the Sequence Layout view preferences), you will have to
ask the program to sort the sequences again.
The sequences can also be sorted by similarity, grouping similar sequences together:
Right-click the name of a sequence | Sort Sequences by Similarity
18.3.6
Delete, rename and add sequences
Sequences can be removed from the alignment by right-clicking the label of a sequence:
right-click label | Delete Sequence
This can be undone by clicking Undo (
) in the Toolbar.
If you wish to delete several sequences, you can check all the sequences, right-click and choose
CHAPTER 18. SEQUENCE ALIGNMENT
294
Delete Marked Sequences. To show the checkboxes, you first have to click the Show Selection
Boxes in the Side Panel.
A sequence can also be renamed:
right-click label | Rename Sequence
This will show a dialog, letting you rename the sequence. This will not affect the sequence that
the alignment is based on.
Extra sequences can be added to the alignment by creating a new alignment where you select
the current alignment and the extra sequences (see section 18.1).
The same procedure can be used for joining two alignments.
18.3.7
Realign selection
If you have created an alignment, it is possible to realign a part of it, leaving the rest of the
alignment unchanged:
select a part of the alignment to realign | right-click the selection | Realign selection
This will open Step 2 in the "Create alignment" dialog, allowing you to set the parameters for the
realignment (see section 18.1).
It is possible for an alignment to become shorter or longer as a result of the realignment of a
region. This is because gaps may have to be inserted in, or deleted from, the sequences not
selected for realignment. This will only occur for entire columns of gaps in these sequences,
ensuring that their relative alignment is unchanged.
Realigning a selection is a very powerful tool for editing alignments in several situations:
• Removing changes. If you change the alignment in a specific region by hand, you may
end up being unhappy with the result. In this case you may of course undo your edits, but
another option is to select the region and realign it.
• Adjusting the number of gaps. If you have a region in an alignment which has too many
gaps in your opinion, you can select the region and realign it. By choosing a relatively high
gap cost you will be able to reduce the number of gaps.
• Combine with fixpoints. If you have an alignment where two residues are not aligned, but
you know that they should have been. You can now set an alignment fixpoint on each of
the two residues, select the region and realign it using the fixpoints. Now, the two residues
are aligned with each other and everything in the selected region around them is adjusted
to accommodate this change.
18.4
Join alignments
CLC Protein Workbench can join several alignments into one. This feature can for example be used
to construct "supergenes" for phylogenetic inference by joining alignments of several disjoint
genes into one spliced alignment. Note, that when alignments are joined, all their annotations
are carried over to the new spliced alignment.
Alignments can be joined by:
CHAPTER 18. SEQUENCE ALIGNMENT
select alignments to join | Toolbox in the Menu Bar | Alignments and Trees (
Join Alignments ( )
295
)|
or select alignments to join | right-click either selected alignment | Toolbox | Alignments and Trees ( ) | Join Alignments ( )
This opens the dialog shown in figure 18.10.
Figure 18.10: Selecting two alignments to be joined.
If you have selected some alignments before choosing the Toolbox action, they are now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove alignments from
the selected elements. Click Next opens the dialog shown in figure 18.11.
Figure 18.11: Selecting order of concatenation.
To adjust the order of concatenation, click the name of one of the alignments, and move it up or
down using the arrow buttons.
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
The result is seen in figure 18.12.
CHAPTER 18. SEQUENCE ALIGNMENT
296
Figure 18.12: The joining of the alignments result in one alignment containing rows of sequences
corresponding to the number of uniquely named sequences in the joined alignments.
18.4.1
How alignments are joined
Alignments are joined by considering the sequence names in the individual alignments. If two
sequences from different alignments have identical names, they are considered to have the
same origin and are thus joined. Consider the joining of alignments A and B. If a sequence
named "in-A-and-B" is found in both A and B, the spliced alignment will contain a sequence
named "in-A-and-B" which represents the characters from A and B joined in direct extension of
each other. If a sequence with the name "in-A-not-B" is found in A but not in B, the spliced
alignment will contain a sequence named "in-A-not-B". The first part of this sequence will contain
the characters from A, but since no sequence information is available from B, a number of gap
characters will be added to the end of the sequence corresponding to the number of residues
in B. Note, that the function does not require that the individual alignments contain an equal
number of sequences.
18.5
Pairwise comparison
For a given set of aligned sequences (see chapter 18) it is possible make a pairwise comparison
in which each pair of sequences are compared to each other. This provides an overview of the
diversity among the sequences in the alignment.
In CLC Protein Workbench this is done by creating a comparison table:
Toolbox in the Menu Bar | Alignments and Trees (
) | Pairwise Comparison (
or right-click alignment in Navigation Area | Toolbox | Alignments and Trees (
Pairwise Comparison ( )
)
) |
This opens the dialog displayed in figure 18.13:
If an alignment was selected before choosing the Toolbox action, this alignment is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove elements from
the Navigation Area. Click Next to adjust parameters.
18.5.1
Pairwise comparison on alignment selection
A pairwise comparison can also be performed for a selected part of an alignment:
right-click on an alignment selection | Pairwise Comparison (
This leads directly to the dialog described in the next section.
)
CHAPTER 18. SEQUENCE ALIGNMENT
297
Figure 18.13: Creating a pairwise comparison table.
18.5.2
Pairwise comparison parameters
There are four kinds of comparison that can be made between the sequences in the alignment,
as shown in figure 18.14.
Figure 18.14: Adjusting parameters for pairwise comparison.
• Gaps Calculates the number of alignment positions where one sequence has a gap and the
other does not.
• Identities Calculates the number of identical alignment positions to overlapping alignment
positions between the two sequences.
• Differences Calculates the number of alignment positions where one sequence is different
from the other. This includes gap differences as in the Gaps comparison.
• Distance Calculates the Jukes-Cantor distance between the two sequences. This number
is given as the Jukes-Cantor correction of the proportion between identical and overlapping
alignment positions between the two sequences.
• Percent identity Calculates the percentage of identical residues in alignment positions to
overlapping alignment positions between the two sequences.
CHAPTER 18. SEQUENCE ALIGNMENT
298
Click Next if you wish to adjust how to handle the results (see section 9.1). If not, click Finish.
18.5.3
The pairwise comparison table
The table shows the results of selected comparisons (see an example in figure 18.15). Since
comparisons are often symmetric, the table can show the results of two comparisons at the
same time, one in the upper-right and one in the lower-left triangle.
Figure 18.15: A pairwise comparison table.
The following settings are present in the side panel:
• Contents
Upper comparison. Selects the comparison to show in the upper triangle of the table
Upper comparison gradient. Selects the color gradient to use for the upper triangle.
Lower comparison Selects the comparison to show in the lower triangle. Choose the
same comparison as in the upper triangle to show all the results of an asymmetric
comparison.
Lower comparison gradient. Selects the color gradient to use for the lower triangle.
Diagonal from upper. Use this setting to show the diagonal results from the upper
comparison.
Diagonal from lower. Use this setting to show the diagonal results from the lower
comparison.
No Diagonal. Leaves the diagonal table entries blank.
• Layout
Lock headers. Locks the sequence labels and table headers when scrolling the table.
Sequence label. Changes the sequence labels.
CHAPTER 18. SEQUENCE ALIGNMENT
299
• Text format
Text size. Changes the size of the table and the text within it.
Font. Changes the font in the table.
Bold. Toggles the use of boldface in the table.
18.6
Bioinformatics explained: Multiple alignments
Multiple alignments are at the core of bioinformatical analysis. Often the first step in a chain of
bioinformatical analyses is to construct a multiple alignment of a number of homologs DNA or
protein sequences. However, despite their frequent use, the development of multiple alignment
algorithms remains one of the algorithmically most challenging areas in bioinformatical research.
Constructing a multiple alignment corresponds to developing a hypothesis of how a number of
sequences have evolved through the processes of character substitution, insertion and deletion.
The input to multiple alignment algorithms is a number of homologous sequences i.e. sequences
that share a common ancestor and most often also share molecular function. The generated
alignment is a table (see figure 18.16) where each row corresponds to an input sequence and
each column corresponds to a position in the alignment. An individual column in this table
represents residues that have all diverged from a common ancestral residue. Gaps in the table
(commonly represented by a '-') represent positions where residues have been inserted or deleted
and thus do not have ancestral counterparts in all sequences.
18.6.1
Use of multiple alignments
Once a multiple alignment is constructed it can form the basis for a number of analyses:
• The phylogenetic relationship of the sequences can be investigated by tree-building methods
based on the alignment.
• Annotation of functional domains, which may only be known for a subset of the sequences,
can be transferred to aligned positions in other un-annotated sequences.
• Conserved regions in the alignment can be found which are prime candidates for holding
functionally important sites.
• Comparative bioinformatical analysis can be performed to identify functionally important
regions.
18.6.2
Constructing multiple alignments
Whereas the optimal solution to the pairwise alignment problem can be found in reasonable
time, the problem of constructing a multiple alignment is much harder.
The first major challenge in the multiple alignment procedure is how to rank different alignments
i.e. which scoring function to use. Since the sequences have a shared history they are correlated
through their phylogeny and the scoring function should ideally take this into account. Doing so
is, however, not straightforward as it increases the number of model parameters considerably.
CHAPTER 18. SEQUENCE ALIGNMENT
300
Figure 18.16: The tabular format of a multiple alignment of 24 Hemoglobin protein sequences.
Sequence names appear at the beginning of each row and the residue position is indicated by
the numbers at the top of the alignment columns. The level of sequence conservation is shown
on a color scale with blue residues being the least conserved and red residues being the most
conserved.
It is therefore commonplace to either ignore this complication and assume sequences to be
unrelated, or to use heuristic corrections for shared ancestry.
The second challenge is to find the optimal alignment given a scoring function. For pairs of
sequences this can be done by dynamic programming algorithms, but for more than three
sequences this approach demands too much computer time and memory to be feasible.
A commonly used approach is therefore to do progressive alignment [Feng and Doolittle, 1987]
where multiple alignments are built through the successive construction of pairwise alignments.
These algorithms provide a good compromise between time spent and the quality of the resulting
alignment
Presently, the most exciting development in multiple alignment methodology is the construction
of statistical alignment algorithms [Hein, 2001], [Hein et al., 2000]. These algorithms employ a
scoring function which incorporates the underlying phylogeny and use an explicit stochastic model
of molecular evolution which makes it possible to compare different solutions in a statistically
rigorous way. The optimization step, however, still relies on dynamic programming and practical
use of these algorithms thus awaits further developments.
Creative Commons License
All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational
purposes, under the following conditions: You must attribute the work in its original form and
"CLC bio" has to be clearly labeled as author and provider of the work. You may not use this
work for commercial purposes. You may not alter, transform, nor build upon this work.
See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on
how to use the contents.
Chapter 19
Phylogenetic trees
Contents
19.1 Inferring phylogenetic trees
. . . . . . . . . . . . . . . . . . . . . . . . . . . 301
19.1.1
Phylogenetic tree parameters . . . . . . . . . . . . . . . . . . . . . . . . 302
19.1.2
Tree View Preferences . . . . . . . . . . . . . . . . . . . . . . . . . . . . 304
19.2 Bioinformatics explained: phylogenetics
. . . . . . . . . . . . . . . . . . . . 306
19.2.1
The phylogenetic tree . . . . . . . . . . . . . . . . . . . . . . . . . . . . 306
19.2.2
Modern usage of phylogenies . . . . . . . . . . . . . . . . . . . . . . . . 307
19.2.3
Reconstructing phylogenies from molecular data
19.2.4
Interpreting phylogenies . . . . . . . . . . . . . . . . . . . . . . . . . . . 309
. . . . . . . . . . . . . 307
CLC Protein Workbench offers different ways of inferring phylogenetic trees. The first part of this
chapter will briefly explain the different ways of inferring trees in CLC Protein Workbench. The
second part, "Bioinformatics explained", will give a more general introduction to the concept of
phylogeny and the associated bioinformatics methods.
19.1
Inferring phylogenetic trees
For a given set of aligned sequences (see chapter 18) it is possible to infer their evolutionary
relationships. In CLC Protein Workbench this may be done either by using a distance based
method (see "Bioinformatics explained" in section 19.2.) or by using the statistically founded
maximum likelihood (ML) approach [Felsenstein, 1981]. Both approaches generate a phylogenetic
tree. The tools are found in:
Toolbox | Alignments and trees (
)
To generate a distance-based phylogenetic tree choose:
Create Tree (
)
and to generate a maximum likelihood based phylogenetic tree choose:
Maximum Likelihood Phylogeny (
)
In both cases the dialog displayed in figure 19.1 will be opened:
301
CHAPTER 19. PHYLOGENETIC TREES
302
Figure 19.1: Creating a Tree.
If an alignment was selected before choosing the Toolbox action, this alignment is now listed in
the Selected Elements window of the dialog. Use the arrows to add or remove elements from
the Navigation Area. Click Next to adjust parameters.
19.1.1
Phylogenetic tree parameters
Distance-based methods
Figure 19.2: Adjusting parameters for distance-based methods.
Figure 19.2 shows the parameters that can be set for the distance-based methods:
• Algorithms
The UPGMA method assumes that evolution has occurred at a constant rate in the
different lineages. This means that a root of the tree is also estimated.
The neighbor joining method builds a tree where the evolutionary rates are free to differ
in different lineages. CLC Protein Workbench always draws trees with roots for practical
reasons, but with the neighbor joining method, no particular biological hypothesis is
postulated by the placement of the root. Figure 19.3 shows the difference between
the two methods.
CHAPTER 19. PHYLOGENETIC TREES
303
• To evaluate the reliability of the inferred trees, CLC Protein Workbench allows the option
of doing a bootstrap analysis. A bootstrap value will be attached to each branch, and
this value is a measure of the confidence in this branch. The number of replicates in the
bootstrap analysis can be adjusted in the wizard. The default value is 100.
For a more detailed explanation, see "Bioinformatics explained" in section 19.2.
Figure 19.3: Method choices for phylogenetic inference. The bottom shows a tree found by neighbor
joining, while the top shows a tree found by UPGMA. The latter method assumes that the evolution
occurs at a constant rate in different lineages.
Maximum likelihood phylogeny
Figure 19.4: Adjusting parameters for ML phylogeny
Figure 19.4 shows the parameters that can be set for the ML phylogenetic tree reconstruction:
• Starting tree: the user is asked to specify a starting tree for the tree reconstruction. There
are three possibilities
Neighbor joining
UPGMA
CHAPTER 19. PHYLOGENETIC TREES
304
Use tree from file.
• Select substitution model: CLC Protein Workbench allows maximum likelihood tree estimation to be performed under the assumption of one of four substitution models: the Jukes
Cantor [Jukes and Cantor, 1969], the Kimura 80 [Kimura, 1980], the HKY [Hasegawa et al.,
1985] and the GTR (also known as the REV model) [Yang, 1994a] models. All models are
time-reversible. The JC and K80 models assume equal base frequencies and the HKY and
GTR models allow the frequencies of the four bases to differ (they will be estimated by the
observed frequencies of the bases in the alignment). In the JC model all substitutions are
assumed to occur at equal rates, in the K80 and HKY models transition and transversion
rates are allowed to differ. The GTR model is the general time reversible model and allows
all substitutions to occur at different rates. In case of the K80 and HKY models the user
may set a transtion/transversion ratio value which will be used as starting value or fixed,
depending on the level of estimation chosen by the user (see below). For the substitution
rate matrices describing the substitution models we use the parametrization of Yang [Yang,
1994a].
• Rate variation: in CLC Protein Workbench substitution rates may be allowed to differ among
the individual nucleotide sites in the alignment by selecting the include rate variation box.
When selected, the discrete gamma model of Yang [Yang, 1994b] is used to model rate
variation among sites. The number of categories used in the dicretization of the gamma
distribution as well as the gamma distribution parameter may be adjusted by the user (as
the gamma distribution is restricted to have mean 1, there is only one parameter in the
distribution)
• Estimation estimation is done according to the maximum likelihood principle, that is, a
search is performed for the values of the free parameters in the model assumed that
results in the highest likelihood of the observed alignment [Felsenstein, 1981]. By ticking
the estimate substitution rate parameters box, maximum likelihood values of the free
parameters in the rate matrix describing the assumed substitution model are found. If the
Estimate topology box is selected, a search in the space of tree topologies for that which
best explains the alignment is performed. If left un-ticked, the starting topology is kept
fixed at that of the starting tree. The Estimate Gamma distribution parameter is active
if rate variation has been included in the model and in this case allows estimation of the
Gamma distribution parameter to be switched on or off. If the box is left un-ticked, the
value is fixed at that given in the Rate variation part. In the absence of rate variation
estimation of substitution parameters and branch lengths are carried out according to
the expectation maximization algorithm [Dempster et al., 1977]. With rate variation the
maximization algorithm is performed. The topology space is searched according to the
PHYML method [Guindon and Gascuel, 2003], allowing efficient search and estimation of
large phylogenies. Branch lengths are given in terms of expected numbers of substitutions
per nucleotide site.
19.1.2
Tree View Preferences
The Tree View preferences are these:
• Text format. Changes the text format for all of the nodes the tree contains.
CHAPTER 19. PHYLOGENETIC TREES
305
Text size. The size of the text representing the nodes can be modified in tiny, small,
medium, large or huge.
Font. Sets the font of the text of all nodes
Bold. Sets the text bold if enabled.
• Tree Layout. Different layouts for the tree.
Node symbol. Changes the symbol of nodes into box, dot, circle or none if you don`t
want a node symbol.
Layout. Displays the tree layout as standard or topology.
Show internal node labels. This allows you to see labels for the internal nodes.
Initially, there are no labels, but right-clicking a node allows you to type a label.
Label color. Changes the color of the labels on the tree nodes.
Branch label color. Modifies the color of the labels on the branches.
Node color. Sets the color of all nodes.
Line color. Alters the color of all lines in the tree.
• Labels. Specifies the text to be displayed in the tree.
Nodes. Sets the annotation of all nodes either to name or to species.
Branches. Changes the annotation of the branches to bootstrap, length or none if you
don`t want annotation on branches.
Note! Dragging in a tree will change it. You are therefore asked if you want to save this tree when
the Tree View is closed.
You may select part of a Tree by clicking on the nodes that you want to select.
Right-click a selected node opens a menu with the following options:
• Set root above node (defines the root of the tree to be just above the selected node).
• Set root at this node (defines the root of the tree to be at the selected node).
• Toggle collapse (collapses or expands the branches below the node).
• Change label (allows you to label or to change the existing label of a node).
• Change branch label (allows you to change the existing label of a branch).
You can also relocate leaves and branches in a tree or change the length. It is possible to modify
the text on the unit measurement at the bottom of the tree view by right-clicking the text. In this
way you can specify a unit, e.g. "years".
Branch lengths are given in terms of expected numbers of substitutions per site.
Note! To drag branches of a tree, you must first click the node one time, and then click the node
again, and this time hold the mouse button.
In order to change the representation:
CHAPTER 19. PHYLOGENETIC TREES
306
• Rearrange leaves and branches by
Select a leaf or branch | Move it up and down (Hint: The mouse turns into an arrow
pointing up and down)
• Change the length of a branch by
Select a leaf or branch | Press Ctrl | Move left and right (Hint: The mouse turns
into an arrow pointing left and right)
Alter the preferences in the Side Panel for changing the presentation of the tree.
19.2
Bioinformatics explained: phylogenetics
Phylogenetics describes the taxonomical classification of organisms based on their evolutionary
history i.e. their phylogeny. Phylogenetics is therefore an integral part of the science of systematics
that aims to establish the phylogeny of organisms based on their characteristics. Furthermore,
phylogenetics is central to evolutionary biology as a whole as it is the condensation of the overall
paradigm of how life arose and developed on earth.
19.2.1
The phylogenetic tree
The evolutionary hypothesis of a phylogeny can be graphically represented by a phylogenetic tree.
Figure 19.5 shows a proposed phylogeny for the great apes, Hominidae, taken in part from
Purvis [Purvis, 1995]. The tree consists of a number of nodes (also termed vertices) and
branches (also termed edges). These nodes can represent either an individual, a species, or
a higher grouping and are thus broadly termed taxonomical units. In this case, the terminal
nodes (also called leaves or tips of the tree) represent extant species of Hominidae and are the
operational taxonomical units (OTUs). The internal nodes, which here represent extinct common
ancestors of the great apes, are termed hypothetical taxonomical units since they are not directly
observable.
Figure 19.5: A proposed phylogeny of the great apes (Hominidae). Different components of the
tree are marked, see text for description.
The ordering of the nodes determine the tree topology and describes how lineages have diverged
over the course of evolution. The branches of the tree represent the amount of evolutionary
divergence between two nodes in the tree and can be based on different measurements. A tree
is completely specified by its topology and the set of all edge lengths.
The phylogenetic tree in figure 19.5 is rooted at the most recent common ancestor of all
Hominidae species, and therefore represents a hypothesis of the direction of evolution e.g. that
CHAPTER 19. PHYLOGENETIC TREES
307
the common ancestor of gorilla, chimpanzee and man existed before the common ancestor
of chimpanzee and man. In contrast, an unrooted tree would represent relationships without
assumptions about ancestry.
19.2.2
Modern usage of phylogenies
Besides evolutionary biology and systematics the inference of phylogenies is central to other
areas of research.
As more and more genetic diversity is being revealed through the completion of multiple
genomes, an active area of research within bioinformatics is the development of comparative
machine learning algorithms that can simultaneously process data from multiple species [Siepel
and Haussler, 2004]. Through the comparative approach, valuable evolutionary information can
be obtained about which amino acid substitutions are functionally tolerant to the organism and
which are not. This information can be used to identify substitutions that affect protein function
and stability, and is of major importance to the study of proteins [Knudsen and Miyamoto,
2001]. Knowledge of the underlying phylogeny is, however, paramount to comparative methods
of inference as the phylogeny describes the underlying correlation from shared history that exists
between data from different species.
In molecular epidemiology of infectious diseases, phylogenetic inference is also an important
tool. The very fast substitution rate of microorganisms, especially the RNA viruses, means that
these show substantial genetic divergence over the time-scale of months and years. Therefore,
the phylogenetic relationship between the pathogens from individuals in an epidemic can be
resolved and contribute valuable epidemiological information about transmission chains and
epidemiologically significant events [Leitner and Albert, 1999], [Forsberg et al., 2001].
19.2.3
Reconstructing phylogenies from molecular data
Traditionally, phylogenies have been constructed from morphological data, but following the
growth of genetic information it has become common practice to construct phylogenies based on
molecular data, known as molecular phylogeny. The data is most commonly represented in the
form of DNA or protein sequences, but can also be in the form of e.g. restriction fragment length
polymorphism (RFLP).
Methods for constructing molecular phylogenies can be distance based or character based.
Distance based methods
Two common algorithms, both based on pairwise distances, are the UPGMA and the Neighbor
Joining algorithms. Thus, the first step in these analyses is to compute a matrix of pairwise
distances between OTUs from their sequence differences. To correct for multiple substitutions it
is common to use distances corrected by a model of molecular evolution such as the Jukes-Cantor
model [Jukes and Cantor, 1969].
UPGMA. A simple but popular clustering algorithm for distance data is Unweighted Pair Group
Method using Arithmetic averages (UPGMA) ( [Michener and Sokal, 1957], [Sneath and Sokal,
1973]). This method works by initially having all sequences in separate clusters and continuously
joining these. The tree is constructed by considering all initial clusters as leaf nodes in the tree,
and each time two clusters are joined, a node is added to the tree as the parent of the two
chosen nodes. The clusters to be joined are chosen as those with minimal pairwise distance.
The branch lengths are set corresponding to the distance between clusters, which is calculated
CHAPTER 19. PHYLOGENETIC TREES
308
as the average distance between pairs of sequences in each cluster.
The algorithm assumes that the distance data has the so-called molecular clock property i.e. the
divergence of sequences occur at the same constant rate at all parts of the tree. This means
that the leaves of UPGMA trees all line up at the extant sequences and that a root is estimated
as part of the procedure.
Figure 19.6: Algorithm choices for phylogenetic inference. The bottom shows a tree found by the
neighbor joining algorithm, while the top shows a tree found by the UPGMA algorithm. The latter
algorithm assumes that the evolution occurs at a constant rate in different lineages.
Neighbor Joining. The neighbor joining algorithm, [Saitou and Nei, 1987], on the other hand,
builds a tree where the evolutionary rates are free to differ in different lineages, i.e., the tree does
not have a particular root. Some programs always draw trees with roots for practical reasons,
but for neighbor joining trees, no particular biological hypothesis is postulated by the placement
of the root. The method works very much like UPGMA. The main difference is that instead of
using pairwise distance, this method subtracts the distance to all other nodes from the pairwise
distance. This is done to take care of situations where the two closest nodes are not neighbors
in the "real" tree. The neighbor join algorithm is generally considered to be fairly good and is
widely used. Algorithms that improves its cubic time performance exist. The improvement is only
significant for quite large datasets.
Character based methods. Whereas the distance based methods compress all sequence
information into a single number, the character based methods attempt to infer the phylogeny
based on all the individual characters (nucleotides or amino acids).
Parsimony. In parsimony based methods a number of sites are defined which are informative
about the topology of the tree. Based on these, the best topology is found by minimizing the
number of substitutions needed to explain the informative sites. Parsimony methods are not
based on explicit evolutionary models.
Maximum Likelihood. Maximum likelihood and Bayesian methods (see below) are probabilistic
methods of inference. Both have the pleasing properties of using explicit models of molecular
evolution and allowing for rigorous statistical inference. However, both approaches are very
computer intensive.
A stochastic model of molecular evolution is used to assign a probability (likelihood) to each
phylogeny, given the sequence data of the OTUs. Maximum likelihood inference [Felsenstein,
CHAPTER 19. PHYLOGENETIC TREES
309
1981] then consists of finding the tree which assign the highest probability to the data.
Bayesian inference. The objective of Bayesian phylogenetic inference is not to infer a single
"correct" phylogeny, but rather to obtain the full posterior probability distribution of all possible
phylogenies. This is obtained by combining the likelihood and the prior probability distribution of
evolutionary parameters. The vast number of possible trees means that bayesian phylogenetics
must be performed by approximative Monte Carlo based methods. [Larget and Simon, 1999],
[Yang and Rannala, 1997].
19.2.4
Interpreting phylogenies
Bootstrap values
A popular way of evaluating the reliability of an inferred phylogenetic tree is bootstrap analysis.
The first step in a bootstrap analysis is to re-sample the alignment columns with replacement.
I.e., in the re-sampled alignment, a given column in the original alignment may occur two or more
times, while some columns may not be represented in the new alignment at all. The re-sampled
alignment represents an estimate of how a different set of sequences from the same genes and
the same species may have evolved on the same tree.
If a new tree reconstruction on the re-sampled alignment results in a tree similar to the original
one, this increases the confidence in the original tree. If, on the other hand, the new tree looks
very different, it means that the inferred tree is unreliable. By re-sampling a number of times
it is possibly to put reliability weights on each internal branch of the inferred tree. If the data
was bootstrapped a 100 times, a bootstrap score of 100 means that the corresponding branch
occurs in all 100 trees made from re-sampled alignments. Thus, a high bootstrap score is a sign
of greater reliability.
Other useful resources
The Tree of Life web-project
http://tolweb.org
Joseph Felsensteins list of phylogeny software
http://evolution.genetics.washington.edu/phylip/software.html
Creative Commons License
All CLC bio's scientific articles are licensed under a Creative Commons Attribution-NonCommercialNoDerivs 2.5 License. You are free to copy, distribute, display, and use the work for educational
purposes, under the following conditions: You must attribute the work in its original form and
"CLC bio" has to be clearly labeled as author and provider of the work. You may not use this
work for commercial purposes. You may not alter, transform, nor build upon this work.
See http://creativecommons.org/licenses/by-nc-nd/2.5/ for more information on
how to use the contents.
Part IV
Appendix
310
Appendix A
Comparison of workbenches
Below we list a number of functionalities that differ between CLC Workbenches and the CLC
Sequence Viewer:
• CLC Sequence Viewer ( )
• CLC Protein Workbench ( )
• CLC DNA Workbench ( )
• CLC RNA Workbench ( )
• CLC Main Workbench ( )
• CLC Genomics Workbench ( )
Data handling
Add multiple locations to Navigation Area
Share data on network drive
Search all your data
Viewer
Protein
DNA
RNA
Main
Genomics
Assembly of sequencing data
Advanced contig assembly
Importing and viewing trace data
Trim sequences
Assemble without use of reference sequence
Map to reference sequence
Assemble to existing contig
Viewing and edit contigs
Tabular view of an assembled contig (easy
data overview)
Secondary peak calling
Multiplexing based on barcode or name
Viewer
Protein
DNA
RNA
Main
Genomics
311
APPENDIX A. COMPARISON OF WORKBENCHES
312
Next-generation Sequencing Data Analysis
Import of 454, Illumina Genome Analyzer,
SOLiD and Helicos data
Reference assembly of human-size genomes
De novo assembly
SNP/DIP detection
Graphical display of large contigs
Support for mixed-data assembly
Paired data support
RNA-Seq analysis
Expression profiling by tags
ChIP-Seq analysis
Viewer
Protein
DNA
RNA
Main
Genomics
Expression Analysis
Import of Illumina BeadChip, Affymetrix, GEO
data
Import of Gene Ontology annotation files
Import of Custom expression data table and
Custom annotation files
Multigroup comparisons
Advanced plots: scatter plot, volcano plot,
box plot and MA plot
Hierarchical clustering
Statistical analysis on count-based and gaussian data
Annotation tests
Principal component analysis (PCA)
Hierarchical clustering and heat maps
Analysis of RNA-Seq/Tag profiling samples
Viewer
Protein
DNA
RNA
Main
Genomics
Molecular cloning
Advanced molecular cloning
Graphical display of in silico cloning
Advanced sequence manipulation
Viewer
Protein
DNA
RNA
Main
Genomics
Database searches
GenBank Entrez searches
UniProt searches (Swiss-Prot/TrEMBL)
Web-based sequence search using BLAST
BLAST on local database
Creation of local BLAST database
PubMed lookup
Web-based lookup of sequence data
Search for structures (at NCBI)
Viewer
Protein
DNA
RNA
Main
Genomics
APPENDIX A. COMPARISON OF WORKBENCHES
313
General sequence analyses
Linear sequence view
Circular sequence view
Text based sequence view
Editing sequences
Adding and editing sequence annotations
Advanced annotation table
Join multiple sequences into one
Sequence statistics
Shuffle sequence
Local complexity region analyses
Advanced protein statistics
Comprehensive protein characteristics report
Viewer
Protein
DNA
RNA
Main
Genomics
Nucleotide analyses
Basic gene finding
Reverse complement without loss of annotation
Restriction site analysis
Advanced interactive restriction site analysis
Translation of sequences from DNA to proteins
Interactive translations of sequences and
alignments
G/C content analyses and graphs
Viewer
Protein
DNA
RNA
Main
Genomics
Protein analyses
3D molecule view
Hydrophobicity analyses
Antigenicity analysis
Protein charge analysis
Reverse translation from protein to DNA
Proteolytic cleavage detection
Prediction of signal peptides (SignalP)
Transmembrane helix prediction (TMHMM)
Secondary protein structure prediction
PFAM domain search
Viewer
Protein
DNA
RNA
Main
Genomics
APPENDIX A. COMPARISON OF WORKBENCHES
314
Sequence alignment
Multiple sequence alignments (Two algorithms)
Advanced re-alignment and fix-point alignment options
Advanced alignment editing options
Join multiple alignments into one
Consensus sequence determination and
management
Conservation score along sequences
Sequence logo graphs along alignments
Gap fraction graphs
Copy annotations between sequences in
alignments
Pairwise comparison
Viewer
Protein
DNA
RNA
Main
Genomics
RNA secondary structure
Advanced prediction of RNA secondary structure
Integrated use of base pairing constraints
Graphical view and editing of secondary structure
Info about energy contributions of structure
elements
Prediction of multiple sub-optimal structures
Evaluate structure hypothesis
Structure scanning
Partition function
Viewer
Protein
DNA
RNA
Main
Genomics
Dot plots
Dot plot based analyses
Viewer
Protein
DNA
RNA
Main
Genomics
Phylogenetic trees
Neighbor-joining and UPGMA phylogenies
Maximum likelihood phylogeny of nucleotides
Viewer
Protein
DNA
RNA
Main
Genomics
Pattern discovery
Search for sequence match
Motif search for basic patterns
Motif search with regular expressions
Motif search with ProSite patterns
Pattern discovery
Viewer
Protein
DNA
RNA
Main
Genomics
APPENDIX A. COMPARISON OF WORKBENCHES
315
Primer design
Advanced primer design tools
Detailed primer and probe parameters
Graphical display of primers
Generation of primer design output
Support for Standard PCR
Support for Nested PCR
Support for TaqMan PCR
Support for Sequencing primers
Alignment based primer design
Alignment based TaqMan probedesign
Match primer with sequence
Ordering of primers
Advanced analysis of primer properties
Viewer
Protein
DNA
RNA
Main
Genomics
Molecular cloning
Advanced molecular cloning
Graphical display of in silico cloning
Advanced sequence manipulation
Viewer
Protein
DNA
RNA
Main
Genomics
Virtual gel view
Fully integrated virtual 1D DNA gel simulator
Viewer
Protein
DNA
RNA
Main
Genomics
For a more detailed comparison, we refer to http://www.clcbio.com/compare.
Appendix B
Graph preferences
This section explains the view settings of graphs. The Graph preferences at the top of the Side
Panel includes the following settings:
• Lock axes. This will always show the axes even though the plot is zoomed to a detailed
level.
• Frame. Shows a frame around the graph.
• Show legends. Shows the data legends.
• Tick type. Determine whether tick lines should be shown outside or inside the frame.
Outside
Inside
• Tick lines at. Choosing Major ticks will show a grid behind the graph.
None
Major ticks
• Horizontal axis range. Sets the range of the horizontal axis (x axis). Enter a value in Min
and Max, and press Enter. This will update the view. If you wait a few seconds without
pressing Enter, the view will also be updated.
• Vertical axis range. Sets the range of the vertical axis (y axis). Enter a value in Min and
Max, and press Enter. This will update the view. If you wait a few seconds without pressing
Enter, the view will also be updated.
• X-axis at zero. This will draw the x axis at y = 0. Note that the axis range will not be
changed.
• Y-axis at zero. This will draw the y axis at x = 0. Note that the axis range will not be
changed.
• Show as histogram. For some data-series it is possible to see the graph as a histogram
rather than a line plot.
316
APPENDIX B. GRAPH PREFERENCES
317
The Lines and plots below contains the following settings:
• Dot type
None
Cross
Plus
Square
Diamond
Circle
Triangle
Reverse triangle
Dot
• Dot color. Allows you to choose between many different colors. Click the color box to select
a color.
• Line width
Thin
Medium
Wide
• Line type
None
Line
Long dash
Short dash
• Line color. Allows you to choose between many different colors. Click the color box to
select a color.
For graphs with multiple data series, you can select which curve the dot and line preferences
should apply to. This setting is at the top of the Side Panel group.
Note that the graph title and the axes titles can be edited simply by clicking with the mouse.
These changes will be saved when you Save ( ) the graph - whereas the changes in the Side
Panel need to be saved explicitly (see section 5.5).
For more information about the graph view, please see section B.
Appendix C
Working with tables
Tables are used in a lot of places in the CLC Protein Workbench. The contents of the tables are
of course different depending on the context, but there are some general features for all tables
that will be explained in the following.
Figure C.1 shows an example of a typical table. This is the table result of Find Open Reading
Frames ( ). We will use this table as an example in the following to illustrate the concepts that
are relevant for all kinds of tables.
Figure C.1: A table showing open reading frames.
First of all, the columns of the table are listed in the Side Panel to the right of the table. By
clicking the checkboxes you can hide/show the columns in the table.
Furthermore, you can sort the table by clicking on the column headers. (Pressing Ctrl - while you click will refine the existing sorting).
318
on Mac
APPENDIX C. WORKING WITH TABLES
C.1
319
Filtering tables
The final concept to introduce is Filtering. The table filter as an advanced and a simple mode.
The simple mode is the default and is applied simply by typing text or numbers (see an example
in figure C.2).
Figure C.2: Typing "neg" in the filter in simple mode.
Typing "neg" in the filter will only show the rows where "neg" is part of the text in any of the
columns (also the ones that are not shown). The text does not have to be in the beginning,
thus "ega" would give the same result. This simple filter works fine for fast, textual and
non-complicated filtering and searching.
However, if you wish to make use of numerical information or make more complex filters, you can
switch to the advanced mode by clicking the Advanced filter ( ) button. The advanced filter is
structure in a different way: First of all, you can have more than one criterion in the filter. Criteria
can be added or removed by clicking the Add ( ) or Remove ( ) buttons. At the top, you can
choose whether all the criteria should be fulfilled (Match all), or if just one of the needs to be
fulfilled (Match any).
For each filter criterion, you first have to select which column it should apply to. Next, you choose
an operator. For numbers, you can choose between:
• = (equal to)
• < (smaller than)
• > (greater than)
• <> (not equal to)
• abs. value < (absolute value smaller than. This is useful if it doesn't matter whether the
number is negative or positive)
• abs. value > (absolute value greater than. This is useful if it doesn't matter whether the
number is negative or positive)
For text-based columns, you can choose between:
• contains (the text does not have to be in the beginning)
• doesn't contain
APPENDIX C. WORKING WITH TABLES
320
• = (the whole text in the table cell has to match, also lower/upper case)
Once you have chosen an operator, you can enter the text or numerical value to use.
If you wish to reset the filter, simply remove ( ) all the search criteria. Note that the last one
will not disappear - it will be reset and allow you to start over.
Figure C.3 shows an example of an advanced filter which displays the open reading frames larger
than 400 that are placed on the negative strand.
Figure C.3: The advanced filter showing open reading frames larger than 400 that are placed on
the negative strand.
Both for the simple and the advanced filter, there is a counter at the upper left corner which tells
you the number of rows that pass the filter (91 in figure C.2 and 15 in figure C.3).
Appendix D
BLAST databases
Several databases are available at NCBI, which can be selected to narrow down the possible
BLAST hits.
D.1
Peptide sequence databases
• nr. Non-redundant GenBank CDS translations + PDB + SwissProt + PIR + PRF, excluding
those in env_nr.
• refseq. Protein sequences from NCBI Reference Sequence project http://www.ncbi.
nlm.nih.gov/RefSeq/.
• swissprot. Last major release of the SWISS-PROT protein sequence database (no incremental updates).
• pat. Proteins from the Patent division of GenBank.
• pdb. Sequences derived from the 3-dimensional structure records from the Protein Data
Bank http://www.rcsb.org/pdb/.
• env_nr. Non-redundant CDS translations from env_nt entries.
• month. All new or revised GenBank CDS translations + PDB + SwissProt + PIR + PRF
released in the last 30 days..
D.2
Nucleotide sequence databases
• nr. All GenBank + EMBL + DDBJ + PDB sequences (but no EST, STS, GSS, or phase 0, 1
or 2 HTGS sequences). No longer "non-redundant" due to computational cost.
• refseq_rna. mRNA sequences from NCBI Reference Sequence Project.
• refseq_genomic. Genomic sequences from NCBI Reference Sequence Project.
• est. Database of GenBank + EMBL + DDBJ sequences from EST division.
• est_human. Human subset of est.
321
APPENDIX D. BLAST DATABASES
322
• est_mouse. Mouse subset of est.
• est_others. Subset of est other than human or mouse.
• gss. Genome Survey Sequence, includes single-pass genomic data, exon-trapped sequences, and Alu PCR sequences.
• htgs. Unfinished High Throughput Genomic Sequences: phases 0, 1 and 2. Finished,
phase 3 HTG sequences are in nr.
• pat. Nucleotides from the Patent division of GenBank.
• pdb. Sequences derived from the 3-dimensional structure records from Protein Data Bank.
They are NOT the coding sequences for the corresponding proteins found in the same PDB
record.
• month. All new or revised GenBank+EMBL+DDBJ+PDB sequences released in the last 30
days.
• alu. Select Alu repeats from REPBASE, suitable for masking Alu repeats from query
sequences. See "Alu alert" by Claverie and Makalowski, Nature 371: 752 (1994).
• dbsts. Database of Sequence Tag Site entries from the STS division of GenBank + EMBL +
DDBJ.
• chromosome. Complete genomes and complete chromosomes from the NCBI Reference
Sequence project. It overlaps with refseq_genomic.
• wgs. Assemblies of Whole Genome Shotgun sequences.
• env_nt. Sequences from environmental samples, such as uncultured bacterial samples
isolated from soil or marine samples. The largest single source is Sagarsso Sea project.
This does overlap with nucleotide nr.
D.3
Adding more databases
Besides the databases that are part of the default configuration, you can add more databases
located at NCBI by configuring files in the Workbench installation directory.
The list of databases that can be added is here: http://www.ncbi.nlm.nih.gov/staff/
tao/URLAPI/remote_blastdblist.html.
In order to add a new database, find the settings folder in the Workbench installation directory
(e.g. C:\Program files\CLC Genomics Workbench 4). Download unzip and place the
following files in this directory to replace the built-in list of databases:
• Nucleotide databases: http://www.clcbio.com/wbsettings/NCBI_BlastNucleotideDatabas
zip
• Protein databases: http://www.clcbio.com/wbsettings/NCBI_BlastProteinDatabases.
zip
Open the file you have downloaded into thesettings folder, e.g. NCBI_BlastProteinDatabases.propert
in a text editor and you will see the contents look like this:
APPENDIX D. BLAST DATABASES
323
nr[clcdefault] = Non-redundant protein sequences
refseq_protein = Reference proteins
swissprot = Swiss-Prot protein sequences
pat = Patented protein sequences
pdb = Protein Data Bank proteins
env_nr = Environmental samples
month = New or revised GenBank sequences
Simply add another database as a new line with the first item being the database name taken from
http://www.ncbi.nlm.nih.gov/staff/tao/URLAPI/remote_blastdblist.html and
the second part is the name to display in the Workbench. Restart the Workbench, and the new
database will be visible in the BLAST dialog.
Appendix E
Proteolytic cleavage enzymes
Most proteolytic enzymes cleave at distinct patterns. Below is a compiled list of proteolytic
enzymes used in CLC Protein Workbench.
324
APPENDIX E. PROTEOLYTIC CLEAVAGE ENZYMES
325
Name
Cyanogen bromide (CNBr)
Asp-N endopeptidase
Arg-C
Lys-C
Trypsin
Trypsin
Trypsin
Trypsin*
Trypsin*
Trypsin*
Trypsin*
Chymotrypsin-high spec.
Chymotrypsin-high spec.
Chymotrypsin-low spec.
Chymotrypsin-low spec.
Chymotrypsin-low spec.
Chymotrypsin-low spec.
P4
-
P3
-
P2
W
M
C, D
C
C
R
-
P1
M
R
K
K, R
K
R
K
K
R
R
F, Y
W
F, L, Y
W
M
H
o-Iodosobenzoate
Thermolysin
-
-
-
W
not D, E
Post-Pro
Glu-C
Asp-N
Proteinase K
-
-
H, K, R
-
Factor Xa
A, F, G, I,
L, T, V, M
I
A, F, G, I,
L, T, V, M
D,E
G
P
E
A, E, F,
I, L, T, V,
W, Y
R
E
A, F, G,
I, L, T, V,
W, A
Y
P
G
P
-
Granzyme B
Thrombin
Thrombin
TEV (Tobacco Etch Virus)
-
P1'
D
not P
P
P
D
H, Y
K
H,R
not P
not M, P
not P
not M, P
not P, Y
not D, M,
P, W
A, F, I, L,
M or V
not P
D
-
P2'
-
-
-
D
R
R
G
not D, E
not D, E
Q
G, S
-
-
Appendix F
Formats for import and export
F.1
List of bioinformatic data formats
Below is a list of bioinformatic data formats, i.e. formats for importing and exporting sequences,
alignments and trees.
326
APPENDIX F. FORMATS FOR IMPORT AND EXPORT
F.1.1
327
Sequence data formats
Import
Export
.fsa/.fasta
X
X
AB1
.ab1
X
Including chromatograms
ABI
.abi
X
Including chromatograms
CLC
.clc
X
Clone Manager
.cm5
X
CSV export
.csv
CSV import
.csv
X
DNAstrider
.str/.strider
X
DS Gene
.bsml
X
Embl
.embl
X
GCG sequence
.gcg
X
GenBank
.gbk/.gb/.gp
X
Gene Construction Kit
.gck
X
Lasergene
.pro/.seq
X
Nexus
.nxs/.nexus
X
Phred
.phd
X
Including chromatograms
PIR (NBRF)
.pir
X
Simple format, name & description
Raw sequence
any
X
Only sequence (no name)
SCF2
.scf
X
Including chromatograms
SCF3
.scf
X
Staden
.sdn
X
Swiss-Prot
.swp
X
Tab delimited text
.txt
Vector NTI archives
.ma4/.pa4/.oa4 X
File type
Suffix
FASTA
Zip export
.zip
Zip import
.zip/.gzip./.tar
Rich format including all information
X
Annotations in csv format
One sequence per line: name; description(optional); sequence
X
X
Only nucleotide sequence
Rich information incl. annotations
X
Rich information incl. annotations
X
X
Including chromatograms
X
Rich information (only proteins)
X
Annotations in tab delimited text format
Archives in rich format
Special import full database
X
X
Simple format, name & description
X
X
Vector NTI Database
Description
Selected files in CLC format
Contained files/folder structure
APPENDIX F. FORMATS FOR IMPORT AND EXPORT
F.1.2
328
Contig formats
Import
Export
.ace
X
X
No chromatogram or quality score
CLC
.clc
X
X
Rich format including all information
Zip export
.zip
X
Selected files in CLC format
Zip import
.zip/.gzip./.tar
File type
Suffix
ACE
F.1.3
X
Contained files/folder structure
Alignment formats
Import
Export
.clc
X
X
Clustal Alignment
.aln
X
X
GCG Alignment
.msf
X
X
Nexus
.nxs/.nexus
X
X
Phylip Alignment
.phy
X
X
Zip export
.zip
Zip import
.zip/.gzip./.tar
File type
Suffix
CLC
F.1.4
Description
X
X
Description
Rich format including all information
Selected files in CLC format
Contained files/folder structure
Tree formats
Import
Export
.clc
X
X
Newick
.nwk
X
X
Nexus
.nxs/.nexus
X
X
Zip export
.zip
Zip import
.zip/.gzip./.tar
File type
Suffix
CLC
X
X
Description
Rich format including all information
Selected files in CLC format
Contained files/folder structure
APPENDIX F. FORMATS FOR IMPORT AND EXPORT
F.1.5
329
Miscellaneous formats
Import
File type
Suffix
BLAST Database
.phr/.nhr
X
CLC
.clc
X
CSV
Export
Description
Link to database imported
X
Rich format including all information
.csv
X
All tables
Excel
.xls/.xlsx
X
All tables and reports
GFF
.gff
X
X
See http://www.clcbio.com/
annotate-with-gff
mmCIF
.cif
X
3D structure
PDB
.pdb
X
3D structure
Tab delimited
.txt
Text
.txt
Zip export
.zip
Zip import
.zip/.gzip./.tar
X
X
All tables
X
All data in a textual format
X
Selected files in CLC format
X
Contained files/folder structure
Note! The Workbench can import 'external' files, too. This means that all kinds of files can be
imported and displayed in the Navigation Area, but the above mentioned formats are the only
ones whose contents can be shown in the Workbench.
F.2
List of graphics data formats
Below is a list of formats for exporting graphics. All data displayed in a graphical format can be
exported using these formats. Data represented in lists and tables can only be exported in .pdf
format (see section 7.3 for further details).
Format
Suffix
Type
Portable Network Graphics
.png
bitmap
JPEG
.jpg
bitmap
Tagged Image File
.tif
bitmap
PostScript
.ps
vector graphics
Encapsulated PostScript
.eps
vector graphics
Portable Document Format
.pdf
vector graphics
Scalable Vector Graphics
.svg
vector graphics
Appendix G
IUPAC codes for amino acids
(Single-letter codes based on International Union of Pure and Applied Chemistry)
The information is gathered from: http://www.ebi.ac.uk/2can/tutorials/aa.html
330
APPENDIX G. IUPAC CODES FOR AMINO ACIDS
One-letter
abbreviation
Three-letter
abbreviation
Description
A
Ala
Alanine
R
Arg
Arginine
N
Asn
Asparagine
D
Asp
Aspartic acid
C
Cys
Cysteine
Q
Gln
Glutamine
E
Glu
Glutamic acid
G
Gly
Glycine
H
His
Histidine
J
Xle
Leucine or Isoleucineucine
L
Leu
Leucine
I
ILe
Isoleucine
K
Lys
Lysine
M
Met
Methionine
F
Phe
Phenylalanine
P
Pro
Proline
O
Pyl
Pyrrolysine
U
Sec
Selenocysteine
S
Ser
Serine
T
Thr
Threonine
W
Trp
Tryptophan
Y
Tyr
Tyrosine
V
Val
Valine
B
Asx
Aspartic acid or Asparagine Asparagine
Z
Glx
Glutamic acid or Glutamine Glutamine
X
Xaa
Any amino acid
331
Appendix H
IUPAC codes for nucleotides
(Single-letter codes based on International Union of Pure and Applied Chemistry)
The information is gathered from: http://www.iupac.org and http://www.ebi.ac.uk/
2can/tutorials/aa.html.
Code
Description
A
Adenine
C
Cytosine
G
Guanine
T
Thymine
U
Uracil
R
Purine (A or G)
Y
Pyrimidine (C, T, or U)
M
C or A
K
T, U, or G
W
T, U, or A
S
C or G
B
C, T, U, or G (not A)
D
A, T, U, or G (not C)
H
A, T, U, or C (not G)
V
A, C, or G (not T, not U)
N
Any base (A, C, G, T, or U)
332
Appendix I
Custom codon frequency tables
You can edit the list of codon frequency tables used by CLC Protein Workbench.
Note! Please be aware that this process needs to be handled carefully, otherwise you may
have to re-install the Workbench to get it to work.
In the Workbench installation folder under res, there is a folder named codonfreq. This folder
contains all the codon frequency tables organized into subfolders in a hierarchy. In order to
change the tables, you simply add, delete or rename folders and the files in the folders. If you
wish to add new tables, please use the existing ones as template.
Restart the Workbench to have the changes take effect.
Please note that when updating the Workbench to a new version, this information is not preserved.
This means that you should keep this information in a separate place as back-up. (The ability to
change the tables is mainly aimed at centrally deployed installations of the Workbench).
333
Bibliography
[Altschul and Gish, 1996] Altschul, S. F. and Gish, W. (1996). Local alignment statistics.
Methods Enzymol, 266:460--480.
[Altschul et al., 1990] Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J.
(1990). Basic local alignment search tool. J Mol Biol, 215(3):403--410.
[Andrade et al., 1998] Andrade, M. A., O'Donoghue, S. I., and Rost, B. (1998). Adaptation of
protein surfaces to subcellular location. J Mol Biol, 276(2):517--525.
[Bachmair et al., 1986] Bachmair, A., Finley, D., and Varshavsky, A. (1986). In vivo half-life of a
protein is a function of its amino-terminal residue. Science, 234(4773):179--186.
[Bateman et al., 2004] Bateman, A., Coin, L., Durbin, R., Finn, R. D., Hollich, V., Griffiths-Jones,
S., Khanna, A., Marshall, M., Moxon, S., Sonnhammer, E. L. L., Studholme, D. J., Yeats, C.,
and Eddy, S. R. (2004). The Pfam protein families database. Nucleic Acids Res, 32(Database
issue):D138--D141.
[Bendtsen et al., 2004a] Bendtsen, J. D., Jensen, L. J., Blom, N., Heijne, G. V., and Brunak, S.
(2004a). Feature-based prediction of non-classical and leaderless protein secretion. Protein
Eng Des Sel, 17(4):349--356.
[Bendtsen et al., 2005] Bendtsen, J. D., Kiemer, L., Fausbøll, A., and Brunak, S. (2005).
Non-classical protein secretion in bacteria. BMC Microbiol, 5:58.
[Bendtsen et al., 2004b] Bendtsen, J. D., Nielsen, H., von Heijne, G., and Brunak, S. (2004b).
Improved prediction of signal peptides: SignalP 3.0. J Mol Biol, 340(4):783--795.
[Blobel, 2000] Blobel, G. (2000). Protein targeting (Nobel lecture). Chembiochem., 1:86--102.
[Clote et al., 2005] Clote, P., Ferré, F., Kranakis, E., and Krizanc, D. (2005). Structural RNA has
lower folding energy than random RNA of the same dinucleotide frequency. RNA, 11(5):578-591.
[Cornette et al., 1987] Cornette, J. L., Cease, K. B., Margalit, H., Spouge, J. L., Berzofsky, J. A.,
and DeLisi, C. (1987). Hydrophobicity scales and computational techniques for detecting
amphipathic structures in proteins. J Mol Biol, 195(3):659--685.
[Crooks et al., 2004] Crooks, G. E., Hon, G., Chandonia, J.-M., and Brenner, S. E. (2004).
WebLogo: a sequence logo generator. Genome Res, 14(6):1188--1190.
[Dayhoff and Schwartz, 1978] Dayhoff, M. O. and Schwartz, R. M. (1978). Atlas of Protein
Sequence and Structure, volume 3 of 5 suppl., pages 353--358. Nat. Biomed. Res. Found.,
Washington D.C.
334
BIBLIOGRAPHY
335
[Dempster et al., 1977] Dempster, A., Laird, N., Rubin, D., et al. (1977). Maximum likelihood
from incomplete data via the EM algorithm. Journal of the Royal Statistical Society, 39(1):1--38.
[Eddy, 2004] Eddy, S. R. (2004). Where did the BLOSUM62 alignment score matrix come from?
Nat Biotechnol, 22(8):1035--1036.
[Eisenberg et al., 1984] Eisenberg, D., Schwarz, E., Komaromy, M., and Wall, R. (1984). Analysis
of membrane and surface protein sequences with the hydrophobic moment plot. J Mol Biol,
179(1):125--142.
[Emini et al., 1985] Emini, E. A., Hughes, J. V., Perlow, D. S., and Boger, J. (1985). Induction of
hepatitis a virus-neutralizing antibody by a virus-specific synthetic peptide. J Virol, 55(3):836-839.
[Engelman et al., 1986] Engelman, D. M., Steitz, T. A., and Goldman, A. (1986). Identifying
nonpolar transbilayer helices in amino acid sequences of membrane proteins. Annu Rev
Biophys Biophys Chem, 15:321--353.
[Felsenstein, 1981] Felsenstein, J. (1981). Evolutionary trees from DNA sequences: a maximum
likelihood approach. J Mol Evol, 17(6):368--376.
[Feng and Doolittle, 1987] Feng, D. F. and Doolittle, R. F. (1987). Progressive sequence alignment as a prerequisite to correct phylogenetic trees. J Mol Evol, 25(4):351--360.
[Forsberg et al., 2001] Forsberg, R., Oleksiewicz, M. B., Petersen, A. M., Hein, J., Bøtner, A., and
Storgaard, T. (2001). A molecular clock dates the common ancestor of European-type porcine
reproductive and respiratory syndrome virus at more than 10 years before the emergence of
disease. Virology, 289(2):174--179.
[Galperin and Koonin, 1998] Galperin, M. Y. and Koonin, E. V. (1998). Sources of systematic
error in functional annotation of genomes: domain rearrangement, non-orthologous gene
displacement and operon disruption. In Silico Biol, 1(1):55--67.
[Gill and von Hippel, 1989] Gill, S. C. and von Hippel, P. H. (1989). Calculation of protein
extinction coefficients from amino acid sequence data. Anal Biochem, 182(2):319--326.
[Gonda et al., 1989] Gonda, D. K., Bachmair, A., Wünning, I., Tobias, J. W., Lane, W. S.,
and Varshavsky, A. (1989). Universality and structure of the N-end rule. J Biol Chem,
264(28):16700--16712.
[Guindon and Gascuel, 2003] Guindon, S. and Gascuel, O. (2003). A Simple, Fast, and Accurate Algorithm to Estimate Large Phylogenies by Maximum Likelihood. Systematic Biology,
52(5):696--704.
[Hasegawa et al., 1985] Hasegawa, M., Kishino, H., and Yano, T. (1985). Dating of the humanape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution,
22(2):160--174.
[Hein, 2001] Hein, J. (2001). An algorithm for statistical alignment of sequences related by a
binary tree. In Pacific Symposium on Biocomputing, page 179.
[Hein et al., 2000] Hein, J., Wiuf, C., Knudsen, B., Møller, M. B., and Wibling, G. (2000).
Statistical alignment: computational properties, homology testing and goodness-of-fit. J Mol
Biol, 302(1):265--279.
BIBLIOGRAPHY
336
[Henikoff and Henikoff, 1992] Henikoff, S. and Henikoff, J. G. (1992). Amino acid substitution
matrices from protein blocks. Proc Natl Acad Sci U S A, 89(22):10915--10919.
[Hopp and Woods, 1983] Hopp, T. P. and Woods, K. R. (1983). A computer program for predicting
protein antigenic determinants. Mol Immunol, 20(4):483--489.
[Ikai, 1980] Ikai, A. (1980). Thermostability and aliphatic index of globular proteins. J Biochem
(Tokyo), 88(6):1895--1898.
[Janin, 1979] Janin, J. (1979). Surface and inside volumes in globular proteins. Nature,
277(5696):491--492.
[Jukes and Cantor, 1969] Jukes, T. and Cantor, C. (1969). Mammalian Protein Metabolism,
chapter Evolution of protein molecules, pages 21--32. New York: Academic Press.
[Karplus and Schulz, 1985] Karplus, P. A. and Schulz, G. E. (1985). Prediction of chain flexibility
in proteins. Naturwissenschaften, 72:212--213.
[Kimura, 1980] Kimura, M. (1980). A simple method for estimating evolutionary rates of base
substitutions through comparative studies of nucleotide sequences. J Mol Evol, 16(2):111-120.
[Klee and Ellis, 2005] Klee, E. W. and Ellis, L. B. M. (2005). Evaluating eukaryotic secreted
protein prediction. BMC Bioinformatics, 6:256.
[Knudsen and Miyamoto, 2001] Knudsen, B. and Miyamoto, M. M. (2001). A likelihood ratio
test for evolutionary rate shifts and functional divergence among proteins. Proc Natl Acad Sci
U S A, 98(25):14512--14517.
[Kolaskar and Tongaonkar, 1990] Kolaskar, A. S. and Tongaonkar, P. C. (1990). A semi-empirical
method for prediction of antigenic determinants on protein antigens. FEBS Lett, 276(1-2):172-174.
[Krogh et al., 2001] Krogh, A., Larsson, B., von Heijne, G., and Sonnhammer, E. L. (2001).
Predicting transmembrane protein topology with a hidden Markov model: application to
complete genomes. J Mol Biol, 305(3):567--580.
[Kyte and Doolittle, 1982] Kyte, J. and Doolittle, R. F. (1982). A simple method for displaying
the hydropathic character of a protein. J Mol Biol, 157(1):105--132.
[Larget and Simon, 1999] Larget, B. and Simon, D. (1999). Markov chain monte carlo algorithms
for the bayesian analysis of phylogenetic trees. Mol Biol Evol, 16:750--759.
[Leitner and Albert, 1999] Leitner, T. and Albert, J. (1999). The molecular clock of HIV-1 unveiled
through analysis of a known transmission history. Proc Natl Acad Sci U S A, 96(19):10752-10757.
[Maizel and Lenk, 1981] Maizel, J. V. and Lenk, R. P. (1981). Enhanced graphic matrix analysis
of nucleic acid and protein sequences. Proc Natl Acad Sci U S A, 78(12):7665--7669.
[McGinnis and Madden, 2004] McGinnis, S. and Madden, T. L. (2004). BLAST: at the core of
a powerful and diverse set of sequence analysis tools. Nucleic Acids Res, 32(Web Server
issue):W20--W25.
BIBLIOGRAPHY
337
[Menne et al., 2000] Menne, K. M., Hermjakob, H., and Apweiler, R. (2000). A comparison
of signal sequence prediction methods using a test set of signal peptides. Bioinformatics,
16(8):741--742.
[Michener and Sokal, 1957] Michener, C. and Sokal, R. (1957). A quantitative approach to a
problem in classification. Evolution, 11:130--162.
[Nielsen et al., 1997] Nielsen, H., Engelbrecht, J., Brunak, S., and von Heijne, G. (1997).
Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage
sites. Protein Eng, 10(1):1--6.
[Purvis, 1995] Purvis, A. (1995). A composite estimate of primate phylogeny. Philos Trans R Soc
Lond B Biol Sci, 348(1326):405--421.
[Reinhardt and Hubbard, 1998] Reinhardt, A. and Hubbard, T. (1998). Using neural networks for
prediction of the subcellular location of proteins. Nucleic Acids Res, 26(9):2230--2236.
[Rose et al., 1985] Rose, G. D., Geselowitz, A. R., Lesser, G. J., Lee, R. H., and Zehfus, M. H.
(1985). Hydrophobicity of amino acid residues in globular proteins. Science, 229(4716):834-838.
[Rost, 2001] Rost, B. (2001). Review: protein secondary structure prediction continues to rise.
J Struct Biol, 134(2-3):204--218.
[Saitou and Nei, 1987] Saitou, N. and Nei, M. (1987). The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol Biol Evol, 4(4):406--425.
[Schechter and Berger, 1967] Schechter, I. and Berger, A. (1967). On the size of the active site
in proteases. I. Papain. Biochem Biophys Res Commun, 27(2):157--162.
[Schechter and Berger, 1968] Schechter, I. and Berger, A. (1968). On the active site of proteases. 3. Mapping the active site of papain; specific peptide inhibitors of papain. Biochem
Biophys Res Commun, 32(5):898--902.
[Schneider and Stephens, 1990] Schneider, T. D. and Stephens, R. M. (1990). Sequence logos:
a new way to display consensus sequences. Nucleic Acids Res, 18(20):6097--6100.
[Siepel and Haussler, 2004] Siepel, A. and Haussler, D. (2004). Combining phylogenetic and
hidden Markov models in biosequence analysis. J Comput Biol, 11(2-3):413--428.
[Smith and Waterman, 1981] Smith, T. F. and Waterman, M. S. (1981). Identification of common
molecular subsequences. J Mol Biol, 147(1):195--197.
[Sneath and Sokal, 1973] Sneath, P. and Sokal, R. (1973). Numerical Taxonomy. Freeman, San
Francisco.
[Tobias et al., 1991] Tobias, J. W., Shrader, T. E., Rocap, G., and Varshavsky, A. (1991). The
N-end rule in bacteria. Science, 254(5036):1374--1377.
[von Heijne, 1986] von Heijne, G. (1986). A new method for predicting signal sequence cleavage
sites. Nucl. Acids Res., 14:4683--4690.
[Welling et al., 1985] Welling, G. W., Weijer, W. J., van der Zee, R., and Welling-Wester, S.
(1985). Prediction of sequential antigenic regions in proteins. FEBS Lett, 188(2):215--218.
BIBLIOGRAPHY
338
[Wootton and Federhen, 1993] Wootton, J. C. and Federhen, S. (1993). Statistics of local
complexity in amino acid sequences and sequence databases. Computers in Chemistry,
17:149--163.
[Yang, 1994a] Yang, Z. (1994a). Estimating the pattern of nucleotide substitution. Journal of
Molecular Evolution, 39(1):105--111.
[Yang, 1994b] Yang, Z. (1994b). Maximum likelihood phylogenetic estimation from DNA sequences with variable rates over sites: Approximate methods. Journal of Molecular Evolution,
39(3):306--314.
[Yang and Rannala, 1997] Yang, Z. and Rannala, B. (1997). Bayesian phylogenetic inference
using DNA sequences: a Markov Chain Monte Carlo Method. Mol Biol Evol, 14(7):717--724.
Part V
Index
339
Index
3D molecule view, 186
export graphics, 193
navigate, 187
output, 193
rotate, 187
zoom, 187
454 sequencing data, 311
AB1, file format, 327
Abbreviations
amino acids, 330
ABI, file format, 327
About CLC Workbenches, 27
Accession number, display, 67
.ace, file format, 329
ACE, file format, 328
Add
annotations, 137, 312
sequences to alignment, 294
Adjust selection, 129
Advanced preferences, 93
Advanced search, 86
Algorithm
alignment, 282
neighbor joining, 308
UPGMA, 307
Align
alignments, 285
protein sequences, tutorial, 54
sequences, 313
Alignment, see Alignments
Alignments, 282, 313
add sequences to, 294
compare, 296
create, 283
edit, 292
fast algorithm, 284
join, 294
multiple, Bioinformatics explained, 299
remove sequences from, 293
view, 288
view annotations on, 133
Aliphatic index, 211
.aln, file format, 329
Alphabetical sorting of folders, 65
Ambiguities, reverse translation, 258
Amino acid composition, 213
Amino acids
abbreviations, 330
UIPAC codes, 330
Annotation
select, 129
Annotation Layout, in Side Panel, 133
Annotation types
define your own, 137
Annotation Types, in Side Panel, 133
Annotations
add, 137
copy to other sequences, 293
edit, 137, 139
in alignments, 293
introduction to, 133
links, 159
overview of, 136
show/hide, 133
table of, 136
types of, 133
view on sequence, 133
viewing, 133
Annotations, add links to, 139
Antigenicity, 242, 313
Append wildcard, search, 149, 152, 155
Arrange
layout of sequence, 38
views in View Area, 73
Assembly, 311
Atomic composition, 213
Audit, 90
Backup, 108
Batch edit element properties, 69
Batch processing
340
INDEX
log of, 120
Bibliography, 338
Bioinformatic data
export, 107
formats, 102, 326
bl2seq, see Local BLAST
BLAST, 312
against a local Database, 165
against NCBI, 162
create database from file system, 174
create database from Navigation Area, 174
create local database, 174
database file format, 329
database management, 175
graphics output, 169
list of databases, 321
parameters, 163
search, 161, 162
specify server URL, 94
table output, 170
tips for specialized searches, 47
tutorial, 44, 47
URL, 94
BLAST database index, 174
BLAST DNA sequence
BLASTn, 162
BLASTx, 162
tBLASTx, 162
BLAST Protein sequence
BLASTp, 163
tBLASTn, 163
BLAST result
search in, 172
BLAST search
Bioinformatics explained, 176
BLOSUM, scoring matrices, 204
Bootstrap values, 309
Borrow floating license, 25
Browser,import sequence from, 104
Bug reporting, 28
C/G content, 126
CDS, translate to protein, 129
Chain flexibility, 126
Cheap end gaps, 284
ChIP-Seq analysis, 311
.cif, file format, 186, 329
Circular view of sequence, 130, 312
.clc, file format, 108, 329
341
CLC Standard Settings, 96
CLC Workbenches, 27
CLC, file format, 327--329
associating with CLC Protein Workbench, 13
Cleavage, 259
the Peptidase Database, 263
Clone Manager, file format, 327
Cloning, 312, 315
Close view, 71
Clustal, file format, 328
Coding sequence, translate to protein, 129
Codon
frequency tables, reverse translation, 257
usage, 258
.col, file format, 329
Color residues, 289
Comments, 141
Common name
batch edit, 69
Compare workbenches, 311
Complexity plot, 207
Configure network, 33
Conflicting enzymes, 274
Consensus sequence, 288, 313
open, 288
Conservation, 288
graphs, 313
Contact information, 12
Contig, 311
Copy, 115
annotations in alignments, 293
elements in Navigation Area, 65
into sequence, 130
search results, GenBank, 151
search results, structure search, 157
search results, UniProt, 154
sequence, 142, 143
sequence selection, 227
text selection, 142
.cpf, file format, 94
.chp, file format, 329
Create
alignment, 283
dot plots, 197
enzyme list, 278
local BLAST database, 174
new folder, 65
workspace, 79
INDEX
Create index file, BLAST database, 174
CSV
export graph data points, 113
formatting of decimal numbers, 107
.csv, file format, 329
CSV, file format, 327, 329
.ct, file format, 329
Custom annotation types, 137
Data
storage location, 63
Data formats
bioinformatic, 326
graphics, 329
Data sharing, 63
Data structure, 63
Database
GenBank, 148
local, 63
NCBI, 173
nucleotide, 321
peptide, 321
shared BLAST database, 173
structure, 154
UniProt, 152
Db source, 141
db_xref references, 159
Delete
element, 68
residues and gaps in alignment, 292
workspace, 80
Description, 141
batch edit, 69
DGE, 312
Digital gene expression, 312
DIP detection, 311
Dipeptide distribution, 214
Discovery studio
file format, 327
Distance, pairwise comparison of sequences in
alignments, 298
DNA translation, 228
DNAstrider, file format, 327
Dot plots, 314
Bioinformatics explained, 200
create, 197
print, 199
Double cutters, 267
Double stranded DNA, 123
342
Download and open
search results, GenBank, 151, 157
search results, UniProt, 154
Download and save
search results, GenBank, 151, 157
search results, UniProt, 154
Download of CLC Protein Workbench, 12
Drag and drop
Navigation Area, 65
search results, GenBank, 151, 157
search results, UniProt, 154
DS Gene
file format, 327
Edit
alignments, 292, 313
annotations, 137, 139, 312
enzymes, 268
sequence, 130
sequences, 312
single bases, 130
Element
delete, 68
rename, 68
.embl, file format, 329
Embl, file format, 327
Encapsulated PostScript, export, 111
End gap cost, 284
End gap costs
cheap end caps, 284
free end gaps, 284
Enzyme list, 278
create, 278
edit, 280
view, 280
.eps-format, export, 111
Error reports, 28
Example data, import, 30
Excel, export file format, 329
Expand selection, 129
Expect, BLAST search, 170
Export
bioinformatic data, 107
dependent objects, 108
folder, 107
graph in csv format, 113
graphics, 109
history, 108
list of formats, 326
INDEX
multiple files, 107
preferences, 94
Side Panel Settings, 92
tables, 329
Export visible area, 110
Export whole view, 110
Expression analysis, 312
Extensions, 30
External files, import and export, 109
Extinction coefficient, 212
Extract sequences, 145
FASTA, file format, 327
Feature request, 28
Feature table, 214
Features, see Annotations
File system, local BLAST database, 174
Filtering restriction enzymes, 269, 271, 279
Find
in GenBank file, 142
in sequence, 127
results from a finished process, 78
Find open reading frames, 230
Fit to pages, print, 100
Fit Width, 77
Fixpoints, for alignments, 286
Floating license, 24
Floating license: use offline, 25
Floating Side Panel, 97
Folder, create new, tutorial, 38
Follow selection, 123
Footer, 101
Format, of the manual, 35
FormatDB, 174
Fragment table, 274
Fragment, select, 129
Fragments, separate on gel, 276
Free end gaps, 284
.fsa, file format, 329
G/C content, 126, 313
Gap
compare number of, 298
delete, 292
extension cost, 284
fraction, 289, 313
insert, 292
open cost, 284
Gb Division, 141
343
.gbk, file format, 329
GCG Alignment, file format, 328
GCG Sequence, file format, 327
.gck, file format, 329
GCK, Gene Construction Kit file format, 327
Gel
separate sequences without restriction enzyme digestion, 276
tabular view of fragments, 274
Gel electrophoresis, 275, 315
marker, 278
view, 276
view preferences, 276
when finding restriction sites, 273
GenBank
view sequence in, 142
file format, 327
search, 148, 312
search sequence in, 158
tutorial, 43
Gene Construction Kit, file format, 327
Gene expression analysis, 312
Gene finding, 230
General preferences, 89
General Sequence Analyses, 195
Genetic code, reverse translation, 257
Getting started tutorial, 37
.gff, file format, 329
Google sequence, 158
Graph
export data points in csv format, 113
Graph Side Panel, 316
Graphics
data formats, 329
export, 109
.gzip, file format, 329
Gzip, file format, 329
Half-life, 212
Handling of results, 118
Header, 101
Heat map, 312
Help, 29
Hide/show Toolbox, 79
High-throughput sequencing, 311
History, 116
export, 108
preserve when exporting, 117
source elements, 117
INDEX
Homology, pairwise comparison of sequences
in alignments, 298
Hydrophobicity, 244, 313
Bioinformatics explained, 247
Chain Flexibility, 248
Cornette, 126, 248
Eisenberg, 126, 247
Emini, 126
Engelman (GES), 126, 247
Hopp-Woods, 126, 248
Janin, 126, 248
Karplus and Schulz, 126
Kolaskar-Tongaonkar, 126, 248
Kyte-Doolittle, 126, 247
Rose, 248
Surface Probability, 248
Welling, 126, 248
ID, license, 19
Illumina Genome Analyzer, 311
Import
bioinformatic data, 103, 104
existing data, 38
FASTA-data, 38
from a web page, 104
list of formats, 326
preferences, 94
raw sequence, 104
Side Panel Settings, 92
using copy paste, 104
Index for searching, 88
Infer Phylogenetic Tree, 301
Insert
gaps, 292
Installation, 12
Invert sequence, 228
Isoelectric point, 211
IUPAC codes
nucleotides, 332
Join
alignments, 294
sequences, 214
.jpg-format, export, 111
Keywords, 141
Label
of sequence, 123
Landscape, Print orientation, 100
344
Lasergene sequence
file format, 327
Latin name
batch edit, 69
Length, 141
License, 15
ID, 19
starting without a license, 27
License server, 24
License server: access offline, 25
Limited mode, 27
Links, from annotations, 139
Linux
installation, 14
installation with RPM-package, 15
List of restriction enzymes, 278
List of sequences, 143
Load enzyme list, 268
Local BLAST, 165
Local BLAST Database, 174
Local BLAST database management, 175
Local BLAST Databases, 172
Local complexity plot, 207, 312
Local Database, BLAST, 165
Locale setting, 90
Location
search in, 86
of selection on sequence, 77
path to, 63
Side Panel, 91
Locations
multiple, 311
Log of batch processing, 120
Logo, sequence, 289, 313
.ma4, file format, 329
Mac OS X installation, 13
Manage BLAST databases, 175
Manipulate sequences, 312, 315
Manual editing, auditing, 90
Manual format, 34
Marker, in gel view, 278
Maximize size of view, 74
Maximum likelihood, 314
Menu Bar, illustration, 62
MFold, 314
mmCIF, file format, 329
Mode toolbar, 76
Modification date, 141
INDEX
Modify enzyme list, 280
Modules, 30
Molecular weight, 211
Motif list, 223
Motif search, 217, 223, 314
Mouse modes, 76
Move
content of a view, 77
elements in Navigation Area, 65
sequences in alignment, 293
.msf, file format, 329
Multiple alignments, 299, 313
Multiselecting, 65
Name, 141
Navigate, 3D structure, 187
Navigation Area, 62
create local BLAST database, 174
illustration, 62
NCBI, 148
search for structures, 154
search sequence in, 158
search, tutorial, 43
NCBI BLAST
add more databases, 322
Negatively charged residues, 213
Neighbor Joining algorithm, 308
Neighbor-joining, 314
Nested PCR primers, 314
Network configuration, 33
Network drive, shared BLAST database, 173
Never show this dialog again, 90
New
feature request, 28
folder, 65
folder, tutorial, 38
sequence, 142
New sequence
create from a selection, 129
Newick, file format, 328
Next-Generation Sequencing, 311
.nexus, file format, 329
Nexus, file format, 327, 328
NGS, 311
.nhr, file format, 329
NHR, file format, 329
Non-standard residues, 125
Nucleotide
info, 125
345
sequence databases, 321
Nucleotides
UIPAC codes, 332
Numbers on sequence, 123
.nwk, file format, 329
.nxs, file format, 329
.oa4, file format, 329
Open
consensus sequence, 288
from clipboard, 104
Open reading frame determination, 230
Open-ended sequence, 230
Order primers, 314
ORF, 230
Organism, 141
Origins from, 117
Overhang
of fragments from restriction digest, 274
Overhang, find restriction enzymes based on,
269, 271, 279
.pa4, file format, 329
Page heading, 101
Page number, 101
Page setup, 100
Pairwise comparison, 296
PAM, scoring matrices, 204
Parameters
search, 149, 152, 155
Partition function, 314
Paste
text to create a new sequence, 104
Paste/copy, 115
Pattern Discovery, 215
Pattern discovery, 314
Pattern Search, 217
PCR primers, 314
.pdb, file format, 186, 329
.seq, file format, 329
PDB, file format, 329
.pdf-format, export, 111
Peptidase, 259
Peptide sequence databases, 321
Percent identity, pairwise comparison of sequences in alignments, 298
Personal information, 28
Pfam domain search, 249, 313
.phr, file format, 329
INDEX
PHR, file format, 329
Phred, file format, 327
.phy, file format, 329
Phylip, file format, 328
Phylogenetic tree, 301, 314
tutorial, 56
Phylogenetics, Bioinformatics explained, 306
.pir, file format, 329
PIR (NBRF), file format, 327
Plot
dot plot, 197
local complexity, 207
Plug-ins, 30
.png-format, export, 111
Polarity colors, 125
Portrait, Print orientation, 100
Positively charged residues, 213
PostScript, export, 111
Preference group, 95
Preferences, 89
advanced, 93
export, 94
General, 89
import, 94
style sheet, 95
toolbar, 91
View, 90
view, 75
Primer
design, 314
design from alignments, 314
Print, 98
3D molecule view, 193
dot plots, 199
preview, 101
visible area, 99
whole view, 99
.pro, file format, 329
Problems when starting up, 29
Processes, 78
Properties, batch edit, 69
Protease, cleavage, 259
Protein
charge, 240, 313
cleavage, 259
hydrophobicity, 247
Isoelectric point, 211
report, 253, 312
346
report, output, 254
signal peptide, 234
statistics, 211
structure prediction, 251
translation, 255
Proteolytic cleavage, 259, 313
Bioinformatics explained, 262
tutorial, 52
Proteolytic enzymes cleavage patterns, 324
Proxy server, 33
.ps-format, export, 111
.psi, file format, 329
PubMed references, search, 159
PubMed references,search, 312
Quick start, 29
Rasmol colors, 125
Reading frame, 230
Realign alignment, 313
Rebase, restriction enzyme database, 278
Rebuild index, 88
Recycle Bin, 68
Redo alignment, 285
Redo/Undo, 72
Reference sequence, 311
References, 338
Region
types, 130
Remove
annotations, 140
sequences from alignment, 293
terminated processes, 78
Rename element, 68
Report program errors, 28
Report, protein, 312
Request new feature, 28
Residue coloring, 125
Restore
deleted elements, 68
size of view, 74
Restriction enzmyes
filter, 269, 271, 279
from certain suppliers, 269, 271, 279
Restriction enzyme list, 278
Restriction enzyme, star activity, 278
Restriction enzymes
methylation, 269, 271, 279
number of cut sites, 267
INDEX
347
hits, number of, 90
in a sequence, 127
in annotations, 127
in Navigation Area, 84
Local BLAST, 165
local data, 311
options, GenBank, 149
options, GenBank structure search, 155
options, UniProt, 152
own motifs, 223
parameters, 149, 152, 155
patterns, 215, 217
Pfam domains, 249
PubMed references, 159
sequence in UniProt, 159
sequence on Google, 158
sequence on NCBI, 158
sequence on web, 158
TrEMBL, 152
troubleshooting, 88
UniProt, 152
Secondary structure
Safe mode, 29
predict RNA, 314
Save
Secondary structure prediction, 251, 313
changes in a view, 72
Select
sequence, 44
exact positions, 127
style sheet, 95
in sequence, 129
view preferences, 95
parts of a sequence, 129
workspace, 79
workspace, 79
Save enzyme list, 268
Select annotation, 129
SCF2, file format, 327
Selection mode in the toolbar, 77
SCF3, file format, 327
Selection, adjust, 129
Score, BLAST search, 170
Selection, expand, 129
Scoring matrices
Selection, location on sequence, 77
Bioinformatics explained, 204
Separate sequences on gel, 276
BLOSUM, 204
using restriction enzymes, 276
PAM, 204
Sequence
Scroll wheel
alignment, 282
to zoom in, 76
analysis, 195
to zoom out, 76
display different information, 67
Search, 86
extract from sequence list, 145
in one location, 86
find, 127
BLAST, 161, 162
information, 141
for structures at NCBI, 154
join, 214
GenBank, 148
layout, 123
GenBank file, 142
lists, 143
handle results from GenBank, 150
logo, 313
handle results from NCBI structure DB, 156
logo Bioinformatics explained, 290
handle results from UniProt, 153
overhang, 269, 271, 279
separate on gel, 276
sorting, 267
Restriction sites, 313
enzyme database Rebase, 278
select fragment, 129
number of, 271
on sequence, 124, 266
parameters, 270
tutorial, 57
Results handling, 118
Reverse complement, 227, 313
Reverse sequence, 228
Reverse translation, 255, 313
Bioinformatics explained, 257
Right-click on Mac, 34
RNA secondary structure, 314
RNA translation, 228
RNA-Seq analysis, 311
.rnaml, file format, 329
Rotate, 3D structure, 187
INDEX
new, 142
region types, 130
search, 127
select, 129
shuffle, 195
statistics, 208
view, 122
view as text, 142
view circular, 130
view format, 67
web info, 158
Sequence logo, 289
Sequencing data, 311
Sequencing primers, 314
Share data, 63, 311
Share Side Panel Settings, 92
Shared BLAST database, 173
Shortcuts, 80
Show
results from a finished process, 78
Show dialogs, 90
Show/hide Toolbox, 79
Shuffle sequence, 195, 312
Side Panel
tutorial, 40
Side Panel Settings
export, 92
import, 92
share with others, 92
Side Panel, location of, 91
Signal peptide, 234, 235, 313
SignalP, 234
Bioinformatics explained, 235
Single base editing
in sequences, 130
Single cutters, 267
SNP detection, 311
Solexa, see Illumina Genome Analyzer
SOLiD data, 311
Sort
sequences alphabetically, 293
sequences by similarity, 293
Sort, folders, 65
Source element, 117
Species, display name, 67
Staden, file format, 327
Standard layout, trees, 305
Standard Settings, CLC, 96
348
Star activity, 278
Start Codon, 230
Start-up problems, 29
Statistics
about sequence, 312
protein, 211
sequence, 208
Status Bar, 78, 79
illustration, 62
.str, file format, 329
Structure scanning, 314
Structure, prediction, 251
Style sheet, preferences, 95
Support mail, 12
Surface probability, 126
.svg-format, export, 111
Swiss-Prot, 152
search, see UniProt
Swiss-Prot, file format, 327
Swiss-Prot/TrEMBL, 312
.swp, file format, 329
System requirements, 15
Tab delimited, file format, 329
Tab, file format, 327
Table of fragments, 274
Tabs, use of, 69
Tag-based expression profiling, 311
TaqMan primers, 314
.tar, file format, 329
Tar, file format, 329
Taxonomy
batch edit, 69
tBLASTn, 163
tBLASTx, 162
Terminated processes, 78
Text format, 128
user manual, 35
view sequence, 142
Text, file format, 329
.tif-format, export, 111
Tips for BLAST searches, 47
TMHMM, 241
Toolbar
illustration, 62
preferences, 91
Toolbox, 78, 79
illustration, 62
show/hide, 79
INDEX
Topology layout, trees, 305
Trace colors, 125
Trace data, 311
Translate
a selection, 126
along DNA sequence, 125
annotation to protein, 129
CDS, 230
coding regions, 230
DNA to RNA, 225
nucleotide sequence, 228
ORF, 230
protein, 255
RNA to DNA, 226
to DNA, 313
to protein, 228, 313
Translation
of a selection, 126
show together with DNA sequence, 125
Transmembrane helix prediction, 241, 313
TrEMBL, search, 152
Trim, 311
TSV, file format, 327
Tutorial
Getting started, 37
.txt, file format, 329
UIPAC codes
amino acids, 330
Undo limit, 89
Undo/Redo, 72
UniProt, 152
search, 152, 312
search sequence in, 159
UPGMA algorithm, 307, 314
Urls, Navigation Area, 109
User defined view settings, 91
User interface, 62
Vector graphics, export, 111
VectorNTI
file format, 327
View, 69
alignment, 288
dot plots, 199
GenBank format, 142
preferences, 75
save changes, 72
sequence, 122
349
sequence as text, 142
View Area, 69
illustration, 62
View preferences, 90
show automatically, 91
style sheet, 95
View settings
user defined, 91
Virtual gel, 315
.vsf, file format for settings, 92
Web page, import sequence from, 104
Wildcard, append to search, 149, 152, 155
Windows installation, 12
Workspace, 79
create, 79
delete, 80
save, 79
select, 79
Wrap sequences, 123
.xls, file format, 329
.xlsx, file format, 329
.xml, file format, 329
Zip, file format, 327--329
Zoom, 76
tutorial, 38
Zoom In, 76
Zoom Out, 76
Zoom to 100% , 77
Zoom, 3D structure, 187